Jin-hua Wen*, Xiao-hua Wei, Xiang-yuan Sheng, De-qing Zhou, Hong-wei Peng, Yan-ni Lu, and Jian Zhou

Department of Pharmacy, the First Affiliated Hospital of Nanchang University, Nanchang 330006, China

Effect of Ursolic Acid on Breast Cancer Resistance Protein-mediated Transport of Rosuvastatin In Vivo and Vitro△

Jin-hua Wen*, Xiao-hua Wei, Xiang-yuan Sheng, De-qing Zhou, Hong-wei Peng, Yan-ni Lu, and Jian Zhou

Department of Pharmacy, the First Affiliated Hospital of Nanchang University, Nanchang 330006, China

ursolic acid； breast cancer resistance protein； rosuvastatin； transport

Objective To evaluate whether ursolic acid can inhibit breast cancer resistance protein （BCRP）-mediated transport of rosuvastatin in vivo and in vitro.

Methods Firstly， we explored the pharmacokinetics of 5-fluorouracil （5-FU， a substrate of BCRP） in rats in the presence or absence of ursolic acid. Secondly， we studied the pharmacokinetics of rosuvastatin in rats in the presence or absence of ursolic acid or Ko143 （inhibitor of BCRP）. Finially， the concentration-dependent transport of rosuvastatin and the inhibitory effects of ursolic acid and Ko143 were examined in Madin-Darby Canine Kidney （MDCK） Ⅱ-BCRP421CC （wild type） cells and MDCKⅡ-BCRP421AA （mutant type） cells.

Results As a result， significant changes in pharmacokinetics parameters of 5-FU were observed in rats following pretreatment with ursolic acid. Both ursolic acid and Ko143 could significantly affect the pharmacokinetics of rosuvastatin. The rosuvastatin transport in the BCRP overexpressing system was increased in a concentration-dependent manner. However， there was no statistical difference in BCRP-mediated transport of rosuvastatin betweent the wild type cells and mutant cells. The same as Ko143， ursolic acid inhibited BCRP-mediated transport of rosuvastatin in vitro.

Conclusion Ursolic acid appears to be a potent modulator of BCRP that affects the pharmacokinetic of rosuvastatin in vivo and inhibits the transport of rosuvastatin in vitro.

Chin Med Sci J 2015； 30（4）:218-225

B REAST cancer resistance protein （BCRP/ABCG2），as one member of ATP-binding cassette （ABC）efflux transporter super-family， is widely expressed in the small intestine， rectum， liver， kidney，stem cells， ovarian， breast， brain， heart， and cancer cells.1In these organs or cells， BCRP acts as one of "gatekeepers" that plays an important role in disposition of drugs in vivo. On the one hand， BCRP could limit substrates to get into viscera， blood brain barrier， and placental barrier. On the other hand， it increases the excretion of some drugs into bile and urine so as to reduce the blood drug concentration in vivo. Numbers of endogenous and exogenous substances，such as topotecan， pitavastatin， estrogen， rosuvastatin，gefitinib， daunomycin， imatinib， sunitinib， mitoxantrone，olmesartan etc. are the substrates of BCRP.2Simultaneously， some chemical substances also are the inhibitors of BCRP. It means that drug-drug interactions may be involved membrane transport by inhibiting the transport function of BCRP. For example， triclabendazole and its metabolites act as ABCG2 inhibitors to participate in drug interactions and modulate ABCG2-mediated pharmacokinetic processes.3Eltrombopag also inhibits transcellular transport of rosuvastatin in Madin-Darby canine kidney （MDCK Ⅱ） cells stably expressing BCRP.4

At the same time， the genetic polymorphism of BCRP is one of the factors that influence the transport function of BCRP.5For example， Keskitalo et al5found that the area under the curve （AUC） and maximum serum concentration（Cmax） of atorvastatin in BCRP421AA type carriers were higher than those in CC carriers. Zhang et al6also found that BCRP421C＞A polymorphism may play an important role in the pharmacokinetics of rosuvastatin in healthy Chinese males， and result showed that AUC and Cmaxwere lower in the 421CC group than those in the 421CA+421AA group. At present， the nonsynonymous 421C＞A single nucleotide polymorphism （SNP） that results in a glycine to lysine （Q141K） amino acid change has been studied most extensively. The Q141K SNP has been found to be linked to decrease of plasma membrane expression of BCRP，decrease of drug transport， or reduction of ATPase activity.7

Therefore， it is necessary to focus on drug-drug interactions based on competing for the same binding site of BCRP. Especially， genetic polymorphism of BCRP may cause serious adverse drug reaction when drug-drug interacions occur.

In China， as the improvement of living level， the incidence of cardiovascular diseases such as hyperlipidemia showed a rising trend year by year. Statins， as inhibitor of 3-hydroxy-3-methylglutaryl coenzyme A （HMG-GoA）reductase， can significantly reduce the blood lipid level and be widely applied for the treatment of cardiovascular diseases. Simultaneously， Chinese herbal medicines such as salvia， hawthorn， gardenia， glossy privet fruit， etc.，were frequently combined with statins to treat the cardiovascular disease. However， Chinese herbal medicines have many kinds of bioactive components that may cause drug-drug interactions and pharmacokinetic change of statins.8

One of our preliminary studies showed that ursolic acid could significantly affect the pharmacokinetics of rosuvastatin in rats， but the underlying mechanisms were not clear.7In another study， we found that ursolic acid could significantly inhibit the organic anion transporting polypeptide 1B1（OATP1B1）-mediated transport of rosuvastatin in vitro，9which may be as one of important reasons for the effect of ursolic acid on the pharmacokinetics of rosuvastatin in vivo. However， rosuvastatin is also the substrate of BCRP1， and according to the result of one study， ursolic acid can significantly inhibit BCRP-mediated transport of some drugs.1OTherefore， it is necessary to explore whether ursolic acid could inhibit BCRP-mediated rosuvastatin transport.

This study firstly explored the effect of ursolic acid on the pharmacokinetics of 5-fluorouracil （5-FU）， one substrate of BCRP. Then we studied the effect of ursolic acid on the pharmacokinetic of rosuvastatin. Finally， we established BCRP overexpressing cell model to study effects of ursolic acid on BCRP-mediated transport of rosuvastatin in vitro. Simultaneously， this study also want to explore whether BCRP 421C＞A polymorphism has effect on transportation of rosuvastatin.

MATERIALS AND METHODS

Grouping and treatment of rats and blood samples collection

A total of 3O Sprague-Dawley rats， weighing 26O-28O g，purchased from the Laboratory Animal Center of Nanchang University， were randomly divided into 5 groups， 6 in each group. Rats in the group one were intraperitoneally injected with 5-FU （substrate of BCRP， Xi'an Haixin Pharmaceutical Co.， Ltd.， China） in physiological saline solution （48 mg/kg）. For the group two， firstly rats orally took 8O mg/kg of ursolic acid （Bioengineering Development Center of Yi Chun Academy of Jiangxi Province， China） for 7 consecutive days， two times per day； on the 7th day， 5-FU saline solution was intraperitoneally injected after ursolic acid being given intragastrically. Then blood samples were collected from the femoral artery at 1， 3， 5， 1O， 2O， 3O， 6O，9O， and 12O minutes. Rats in the group three were orallyadministrated with rosuvastatin （5O mg/kg， Lunan Beite Pharmaceutical Co. Ltd.， China）. Rats in the group four and five were firstly given 8O mg/kg of ursolic acid （orally） and Ko143 （intravenously， inhibitor of BCRP， Sigma Chemical Co.， MO， USA） respectively for 7 consecutive days， two times per day； on the 7th day， after ursolic acid being given orally and Ko143 injected intravenously， 5O mg/kg of rosuvastatin was orally administrated. Blood samples were also collected from the femoral artery at O.5， 1， 1.5， 3， 5， 8，1O， 12， and 24 hours. Blood samples were centrifuged and the obtained plasma was stored at -2O°C until analysis. All animal studies were performed in accordance with the guidelines of National Institutes of Health for the Care and Use of Laboratory Animals.

Determining concentration of 5-FU and rosuvastatain

Plasma concentration of 5-FU was determined by High Performance Liquid Chromatography （HPLC）. The chromatographic separation was performed on an Agilent HC-C18（4.6×15O mm， 5 μm， Agilent Co.， USA） with the mobile phrase of methanol and water （containing O.1% of acetic acid； 9O：1O， v/v） at a flow rate of 1.O ml/min. The column and autosampler temperatures were kept constant at 3O°C and 4°C， respectively.

Plasma concentration of rosuvastatin was determined by liquid chromatography-mass spectrometry （LC-MS）with the Shimadzu LC/MS 2O1OEV system （Shimadzu Co.，Japan）. A Shim-pack GVP-ODS C18 guard column and a mobile phase consisting of O.4% aqueous ammonia solution in O.2 mmol/L ammonium acetate （A） and methanol （B） at a flow rate of O.2 ml/min were applied. The ratio of A：B was 29：71. Pitavastatin was used as the internal standard. The analysis was performed in selective ion monitoring mode at m/z 42O.O for pitavastatin and m/z 48O.O for rosuvastatin.8

Plasmid construction

BCRP gene cloning primers were as follows： BCRP421CC forward： 5'GCGCAAGCTTATGTCTTCCAGTAATGTCGAA3'（Hind Ⅲ）， reverse： 5'GCGCTCTAGATTAAGGGGAAATTTAAGAATA3' （Xba1）； BCRP421AA forward： 5'GGCACTCTGACGGTGAGAGAAAACTTAAAGTTCTCAGCAG3'， reverse：5' GTTGTTGCAAGCCGAAGAGCTGCTGAGAACTTTAAGTTTT3'. Gene cloning and amplification were described in previous study.11，12

Cell transfection and detection of BCRP expression The polarized MDCK Ⅱ cells was purchased from the Shanghai Institute of Cell Biology， Chinese Academy of Sciences. Cell transfection was manipulated by using Lipofectamine 2OOO （Life Technologies， USA） following the manufacturer's instructions. Cell immunofluorescence assay and flow cytometry were applied to check the transfection rate. Primary antibody （mouse anti-BCRP/ ABCG2 antibody） was purchased from Abcam Co. （USA）and secondary antibody （goat-anti mouse IgG-FITC antibody） was purchased from Santa Cruz Biotechnology（USA）.

RT-PCR was applied to detect the expression of BCRP mRNA in MDCKⅡ-BCRP cells.1O，12MDCKⅡ cells and MDCKⅡ-BCRP cells were cultured in DMEM （Invitrogen， CA，USA） supplemented with 1O% fetal bovine serum （Gibco，USA）. All cells were grown in a humidified atmosphere at 37°C in 5% CO2. A solution of O.25% trypsin-EDTA （Gibco Laboratories， Invitrogen Co， NY， USA） was used to detach the cells from flasks.

Measurement of transport of rosuvastatin across MDCK Ⅱ-BCRP monolayer cells13

Transport of rosuvastatin across the MDCKⅡ-BCRP monolayer cells was studied using monolayer cells 3-4 days post seeding. To measure concentration-dependent apical-to-basal （A-B） transport of rosuvastatin， 1.5 ml of Hank's balanced salt solution （HBSS， Gibco Laboratories）containing various concentrations of rosuvastatin （1-8O μmol/L） was added to the apical side of the insert and 2.6 ml of HBSS without the drug was added to the basal side. For measurement of the basal side to apical side transport（B-A）， 2.6 ml of HBSS containing various concentrations of rosuvastatin （1-8O μmol/L） was added to the basal side and 1.5 ml of HBSS without the drug was added to the apical side. Rosuvastatin solutions were freshly prepared by dissolving it in dimethyl sulfoxide （DMSO）. The final concentration of DMSO in the HBSS was below O.1%. The monolayers were incubated at 37°C， and then placed in a shaker at 5O×g during the transport process to minimize the influence of the aqueous boundary layer. Samples were taken from the receptor chamber at 1O minutes， followed by an immediate replacement of the same volume of prewarmed fresh HBSS. The concentration of rosuvastatin of the apical or basal side was measured using LC-MS after each medium replacement.

Measurement of inhibitory effect of ursolic acid on BCRP-mediated rosuvastatin transport

For the measurement of inhibitory effect of ursolic acid or Ko143 on the A-B transport of rosuvastatin， 1.5 ml of HBSS containing rosuvastatin （1O μmol） was added to the apical side of the insert in the absence or presence of ursolic acid（5-5O μmol） or Ko143 （5-5O μmol）， and 2.6 ml of HBSSwithout rosuvastatin were added to the basal side of the insert. To measure B-A transport of rosuvastatin in the absence or presence of ursolic acid or Ko143， 1.5 ml of HBSS containing rosuvastatin （1O μmol/L） were added to the basal side of the insert in the absence or presence of ursolic acid （5-5O μmol/L） or Ko143 （5-5O μmol/L）， and 2.6 ml of HBSS without rosuvastatin were added to the apical side. The concentration of rosuvastatin of the apical or basal sides was measured using LC-MS after each medium replacement （chromatogram of rosuvastatin shown in Fig. 1）.

Analytical procedures

The apparent permeability coefficient （Papp） was calculated by Equation 1 formula. According to equation 2， efflux ratio（ER） was calculated. According to the equation 3， net ER was calculated. Equation 1： Papp=（△Q/△t）/（A·CO）， where△Q was the drug transport volume in △t， A is the cross-sectional area （4.2 cm2）， and CO（lg/ml） is the initial drug concentration in the donor compartment at t = O minute. Equation 2： ER=PappBL-AP/PappAP-BL（PappAP-BLas the apparent permeability coefficient of drug from apical side to basal side， PappBL-APas the apparent permeability coefficient of drug from basal side to apical side）. Equation 3：Net ER=ERMDCKⅡ- BCRP/ERMDCKⅡ.

Statistical analysis

Pharmacokinetic parameters were calculated by DAS 2.O software. All were presented as mean ± standard deviation. Student's t test or one-way analysis of variance was used for statistical analysis with SPSS 12.O software. A P value ＜O.O5 was considered as statistically significant.

RESULTS

Effects of ursolic acid on pharmacokinetics of 5-FU

The mean plasma concentration-time profiles of 5-FU in the presence or absence of ursolic acid in rats are illustrated in Fig. 2. As shown in Table 1， the pretreatment with ursolic acid （8O mg/kg） significantly altered the pharmacokinetics of 5-FU compared to the control rats given 5-FU alone. There were obviously changes of peak concentration （Cmax）， area under the plasma concentration-time curve from zero to t （AUCO-t）， area under the plasma concentration-time curve from zero to infinity （AUCO-∞）， and clearance rate （CLz/F）（all P＜O.O5），but there were no differences in the parameters of peak time （Tmax） and half life （T1/2） （all P＞O.O5）. The result showed that ursolic acid could significantly affect the features of 5-FU pharmacokinetics. It can increase the degree of absorption， but slow down the process of elimination of 5-FU.

Effects of ursolic acid and Ko143 on the pharmacokinetic of rosuvastatin

Both ursolic acid and Ko143 had significant effect on the pharmacokinetics of rosuvastatin in rats. The results showed that Cmax， AUCO-t， and AUCO-∞were all increased when rats were firstly administrated with ursolic acid （all P＜O.O5）. By contrast， the CLz/Fwas decreased （all P＜O.O5）. But there were no differences in the parameters of Tmaxand T1/2（all P＞O.O5） （Table 2 and Fig. 3）. The same as Ko143， ursolic acid also may act as an inhibitor of BCRP that increase the absorption of rosuvastain in rats.

BCRP expression in MDCK Ⅱ cells

RT-PCR showed wild type and mutant BCRP were expressed in MDCK Ⅱ-BCRP421CC and MDCK Ⅱ-BCRP421AA cells，respectively （Fig. 4）. BCRP protein was expressed in both cellular models. The green fluorescent photoes of MDCKⅡ-BCRP cells are shown in Fig. 4.

Transport of rosuvastatin in MDCK Ⅱ-BCRP monolayer cells

The transport of rosuvastatin increased linearly in concentration range from 5 to 2O μmol/L. When concentration was increased to 4O μmol/L， the uptake of rosuvastatin presented saturation （Fig. 5）. In addition， the transport of rosuvastatin in MDCKⅡ-BCRP421AA monolayer cells was lower than that in the MDCK Ⅱ-BCRP421CC monolayer cells as increasing of rosuvastatin concentration （Table 3）. We had done these experiments two time and the results were almost the same. However， because the BCRP overexpression cellular model is a transient transfection model， we cannot confirm whether there may be no obvious difference in these two cellular models.

Effects of Ko143 and ursolic acid on the transport of rosuvastatin across MDCK Ⅱ-BCRP monolayer cells

The Papp coefficients of rosuvastatin across MDCK Ⅱ-BCRP monolayer cells in the A-B and B-A directions， in the presence versus absence of Ko143 or ursolic acid， are presented in Table 3. In the efflux direction （B-A）， the Papp of rosuvastatin was significantly decreased when Ko143 or ursolic acid was added in MDCK Ⅱ-BCRP monolayer cells（all P＜O.O5）. Simultaneously， the net ERs were also significantly changed （all P＜O.O5）. However， BCRP 421C＞A did not produce an apparent effect on Papp ER and net ER of rosuvastatin. These results suggested that the efflux transport of rosuvastatin was affected by Ko143 orursolic acid. Ursolic acid also acted as an inhibitor of BCRP. BCRP 421C＞A had no effect on the BCRP mediated transport of rosuvastatin.

Simultaneously， this study also found that the presence of ursolic acid or Ko143 inhibited B-A transport of rosuvastatin in a concentration-dependent manner （Fig. 6）. When the concentration of ursolic acid or Ko143 was increased to 25 μmmol/L， transport of rosuvastatin was inhibited about 49% or 67%， respectively. It indicated that ursolic acid also inhibited BCRP-mediated rosuvastatin transport.

Figure 1. Chromatogram of rosuvastatin in cell samples.

Figure 2. Mean plasma concentration-time profiles of 5-fluorouracil following an intraperitoneal injection of 5-fluorouracil to rats in the presence or absence of ursolic acid （mean ± SD， n=6）.

Table 1. Pharmacokinetic parameters of 5-fluorouracil after an oral administration of ursolic acid to rats§（n=6）

Table 2. Pharmacokinetic parameters of rosuvastatin after administration of ursolic acid or Ko143 to rats§（n=6）

Figure 3. Mean plasma concentration-time profiles of rosuvastatin following an oral administration of rosuvastatin to rats in the presence or absence of ursolic acid or Ko143 （mean ± SD， n=6）.

Figure 4. Expression of BCRP in cells and green fluorescent photos of MDCK Ⅱ-BCRP cells.

Figure 5. Concentration-dependent uptake of rosuvastatin in MDCK Ⅱ-BCRP cells （n=6）.

Table 3. Effect of ursolic acid and Ko143 on the Papp efflux ratio and net efflux ratio of rosuvastatin across MDCK II and MDCK Ⅱ-BCRP monolayer cells§（n=5）

Figure 6. Inhibitory effects of ursolic acid （A） and Ko143 （B）on the transport of rosuvastatin （1O μmol/L） across MDCK Ⅱ-BCRP monolayer cells. Each data point represents the mean±SD of five independent experiments.

DISCUSSION

Rosuvastain， as one of novel statins， with a strong effect on reducing blood lipid， was widely applied in clinic for treatment of cardiovascular disease. In addition， traditional Chinese medicines were usually combined with statins so as to treat cardiovascular disease more effectively. However， we do not know whether these combinations will produce drug-drug interactions. It is necessary to pay our attention. In one of our previous studies， experimental results showed that ursolic acid， one component of the traditional Chinese medicine， could significantly affect the pharmacokinetic process of rosuvastatin in rats， performance in the increasing Cmaxand AUC values.8

Because rosuvastatin is the substrate of both OATPs and BCRP1，14and ursolic acid has inhibitory effect on OATPs and BCRP-mediated transport of some drugs，15we wondered whether the effect of ursolic acid on the pharmacokinetis of rosuvastatin might be closely related with the transporters.

We found that ursolic acid could significantly affect OATP1B1-mediated transport of rosuvastatin in our previously established HEK293-OATP1B1 cell model.8In further， it needs to explore whether ursolic acid affects BCRP-mediated transport of rosuvastatin.

Firstly， we explored whether ursolic acid affected thepharmacokinetis of 5-FU that was the substrate of BCRP. As a result， we found that the pharmacokinetics paremeters of Cmax， AUCO-t， and AUCO-∞were increased about 54%， 1O2%，and 174%， respectively. Then， we studied the effect of ursolic acid and BCRP inhibitor on the pharmacokinetics of rosuvastatin. The result showed that the pharmacokinetic paramerters of Cmax， AUCO-t， and AUCO-∞were all increased significantly. Therefore， it demonstrated ursolic acid may act as an inhibitor of BCRP and increase intestinal absorption of 5-FU and rosuvastatin. However， 5-FU is also the substrate of other drug transporter， therefore， we cannot confirm whether ursolic acid induced pharmacokinetic change of 5-FU was depended on BCRP.

To investigate the effects of ursolic acid on BCRP-mediated transport of rosuvastatin， we established MDCKⅡ-BCRP monolayer cellular model. At the same time， considering that genetic polymorphism of BCRP could change the pharmacokinetics of rosuvastatin， we also studied whether the mutation of BCRP has effect on these experiments.

The results showed that the net ER was greater than 2 folds， suggesting that rosuvastatin was a substrate of BCRP. But the BCRP mutant and wild type has not significantly effect on net ER （2.55 vs. 2.58）. When BCRP inhibitor Ko143 was added， the net ERs decreased to 1.5O and 1.37 in MDCK Ⅱ-BCRP mutant and wild type monolayer cell models， respectively. While when ursolic acid was added，the net ERs decreased to 1.85 and 1.7O， in the two different cell models. Simultaneously， we found that ursolic acid or Ko143 inhibited B-A transport of rosuvastatin in a concentration-dependent manner.

These results confirmed that the same as Ko143，ursolic acid also acts as the BCRP inhibitor. However， by contrast， in previous study， we found that ursolic acid had no effect on transport of rosuvastatin in Caco-2 cell model.13It is difficult to explain this contradiction. It is possible that Caco-2 cells mainly express P-gp， and also express uptake transporter such as OATPs. As a result，ursolic acid did not perform as an inhibitor of rosuvastatin transport in the Caco-2 cells， and the exact molecular mechanism needs to be explored in the future study.

In conclusion， ursolic acid appears to be a potent modulator of BCRP that affects the pharmacokinetic of rosuvastatin in vivo and inhibit the transport of rosuvastatin in vitro.

REFERENCES

1. Wen JH， Wei XH， Hu JF. The role of OATP1B1 and BCRP in pharmacokinetics and DDI of novel statins. Cardiovasc Ther 2O12； 3O：e234-41.

2. Hirano M， Maeda K， Matsushima S， et al. Involvement of BCRP （ABCG2） in the biliary excretion of pitavastatin. Mol Pharmacol 2OO5； 68：8OO-7.

3. Barrera B， Otero JA， Egido E， et al. The anthelmintic triclabendazole and its metabolites inhibit the membrane transporter ABCG2/BCRP. Antimicrob Agents Chemother 2O12； 56：3535-43.

4. Takeuchi K， Sugiura T， Matsubara K， et al. Interaction of novel platelet-increasing agent eltrombopag with rosuvastatin via breast cancer resistance protein in humans. Drug Metab Dispos 2O14； 42：726-34.

5. Keskitalo JE， Zolk O， Fromm MF， et al. ABCG2 polymorphism markedly affects the pharmacokinetics of atorvastatin and rosuvastatin. Clin Pharmacol Ther 2OO9； 86：197-2O3.

6. Zhang W， Yu BN， He YJ， et al. Role of BCRP 421C＞A polymorphism on rosuvastatin pharmacokinetics in healthy Chinese males. Clin Chim Acta 2OO6； 373：99-1O3.

7. Tamura A， Watanabe M， Saito H， et al. Functional validation of the genetic polymorphisms of human ATP-binding cassette （ABC） transporter ABCG2： identification of alleles that are defective in porphyrin transport. Mol Pharmacol 2OO6； 7O：287-96.

8. Wen JH， Xiong YQ. The effect of herbal medicine Danshensu and ursolic acid on pharmacokinetics of rosuvastatin in rats. Eur J Drug Metab Pharmacokinet 2O11； 36：2O5-11.

9. Wen JH， Wei XH， Fu YN， et al. The influence of herbal medicine ursolic acid on the uptake of rosuvastatin mediated by OATP1B1*1a and *5. Eur J Drug Metab Pharmacokinet 2O14；39：221-3O.

1O. Tan KW， Li Y， Paxton JW， et al. Identification of novel dietary phytochemicals inhibiting the efflux transporter breast cancer resistance protein （BCRP/ABCG2）. Food Chem 2O13； 138：2267-74.

11. Wang Z， Pal D， Patel A， et al. Influence of overexpression of efflux proteins on the function and gene expression of endogenous peptide transporters in MDR-transfected MDCK Ⅳ cell lines. Int J Pharm 2O13； 441：4O-9.

12. Enokizono J， Kusuhara H， Sugiyama Y. Effect of breast cancer resistance protein （Bcrp/Abcg2） on the disposition of phytoestrogens. Mol Pharmacol 2OO7； 72：967-75.

13. Wen JH， Hu JF， Wei XH. Transepithelial transport of rosuvastatin and effect of ursolic acid on its transport in Caco-2 monolayers. Eur J Drug Metab Pharmacokinet 2O12； 37：225-31.

14. Haberer LJ， McSherry I， Cargill A， et al. Effects of vercirnon on the activity of CYP3A4， CYP2C19 and CYP2C8 enzymes and BCRP and OATP1B1 transporters using probe substrates. Eur， J Clin Pharma 2O14； 7O： 37-45.

15. Gui C， Obaidat A， Chaguturu R， et al. Development of a cell-based high-throughput assay to screen for inhibitors of organic anion transporting polypeptides 1B1 and 1B3. Curr Chem Genomics 2O1O； 4：1-8.

for publication May 19, 2015.

*Correspondence author Tel: 86-791-88699340, Fax: 86-791-88699340, E-mail: wenjh866@163.com

△Supported by the National Natural Science Foundation of China (81202583), the Education Department of Jiangxi Province (GJJ12145) and Research Fund Project for Traditional Chinese Medicine of the Health Department of Jiangxi Province (2012A137), and the Department of Science and Technology of Jiangxi Province (20151BBG70214).