Pi-Liang Xue, Li-Qi Li, Mei-Xiu Xu, Xing-Yu Li, Shun Wang,2?

1. Heilongjiang Academy of Traditional Chinese Medicine, Harbin 150036, China

2. Heilongjiang University of Traditional Chinese Medicine, Harbin 150042, China

Keywords:Membranous nephropathy Shenqi Zhilong Decoction ERK/cPLA2 pathway Nephrin-Podocin-Neph1 receptor complex

ABSTRACT Objective: To explore the therapeutic effect and underlying mechanism of Shenqi Zhilong Decoction on mice with membranous nephropathy (MN). Methods:Mice with MN was established by injecting cationic bovine serum albumin (c-BSA) into tail vein for several times.model mice were randomly divided into MN group (equal amount of distilled water), Shenqi Zhilong Decoction low dose group (12 g crude drug/kg), Shenqi Zhilong Decoction high dose group (24 g crude drug/kg), and Tripterygium wilfordii polyglycoside tablet group (14 mg/kg). Another 10 un-treatment mice were taken as control group (equal amount of distilled water). The drug was administered orally once a day for 4 weeks. After the last administration,24 hours urine was collected to determine the urinary protein content; blood from inner canthus was collected to measure the changes of kidney function, liver function, blood lipid and levels of IL-6, IL-4 and TNF-α in serum in each group; HE staining was used to observe the pathological changes of kidney. Immunohistochemical staining was used to observe the expression of IgG in kidney. The protein expression of ERK1/2 and cPLA2 in renal tissues was determined by Western-blot method. The gene expression of Neph1, Nephrin and Podocin mRNA in kidney tissues were detected by RT-PCR. Results: Compared with model group,Shenqi Zhilong decoction at low-dose and high-dose could significantly reduce the value of urine protein in MN mice; Decreased TC and TG levels (P＜0.05 or P＜0.01); Increased the levels of ALB and TP in liver function (P＜0.05 or P＜0.01); has no significant effects on the levels of CRE, UREA and UA in renal function (P＞0.05). Decreased the contents of IL-6, IL-4 and TNF-α in serum (P＜0.05 or P＜0.01); Significantly down-regulated the protein expression levels of p-ERK1/2 and p-cPLA2 in kidney tissues of MN mice (P＜0.05 or P＜0.01);Significantly increased the expression levels of NephP1, Nephrin and Podocin mRNA in renal tissues (P＜0.01). Conclusion: Shenqi Zhulong Decoction has a good therapeutic effect on MN mice, and the mechanism of action is related to regulate the expression of related genes of Nephrin-Podocin-Neph1 receptor complex for protecting the glomerular filtration barrier, and inhibite the activation of ERK/cPLA2 pathway for relieving damage of GEC and reduceing secretion of pro-inflammatory cytokines.

1. Introduction

Membranous nephropathy (MN) is one of the main pathological types of adult nephrotic syndrome (NS), accounting for about 20%of adult ns [1]. The main pathological features of Mn are glomerular basement membrane thickening, diffuse deposition of immune complexes under the epithelium and deposition of IgG particles along the capillary loop. The main clinical manifestations are edema, hyperlipidemia, hypoalbuminemia and massive proteinuria[2]. From 2003 to 2014, the incidence rate of MN increased nearly twice, and the incidence rate was only next to IgA nephropathy. 1/3 of the patients developed [3-4].

Clinically, the therapeutic effect of Western Medicine on Mn is not ideal. Rituximab or cyclophosphamide (CTX) combined with steroids is the main method for clinical treatment of Mn. However,the occurrence of side effects such as infection, nephrotoxicity,bone marrow toxicity and cancer, as well as the recurrence of most patients after drug withdrawal, lead to multiple hospitalizations [5-7].In recent years, traditional Chinese medicine has achieved better curative effect in the treatment of Mn. Compared with western medicine, traditional Chinese medicine can faster improve the level of serum albumin, so as to better alleviate the symptoms of edema and fatigue, and has less adverse reactions [8].

Traditional Chinese medicine believes that the pathogenesis of this disease is mainly deficiency of both spleen and kidney, dampness,turbidity and blood stasis. The main treatment principle is to tonify the spleen and kidney, remove blood stasis and diuresis [9].Shenqi Zhilong decoction is a compound preparation for clinical treatment of Mn. It has been in clinical application for more than 10 years and has remarkable curative effect [10]. Astragalus membranaceus, Codonopsis pilosula and epimedium are the king drugs in this prescription. Astragalus membranaceus is an important medicine for tonifying Qi, which can lift Yang Qi, promote water and reduce swelling; Dangshen tonifies the Qi of the spleen and stomach; Epimedium can invigorate the vital gate, replenish vital energy, facilitate urination, tonify the kidney and strengthen yang.Ligusticum chuanxiong, Angelica sinensis, stiff silkworm, leech and earthworm are official drugs, among which Ligusticum chuanxiong promotes blood circulation and Qi; Angelica sinensis nourishes and promotes blood circulation; Dilong dredges meridians and facilitates urination; Stiff silkworm dissolves phlegm, softens hard and disperses knot; Leech cures evil blood, blood stasis, closing the moon, breaking blood accumulation and benefiting waterways.Fengwei grass and Polygonum cuspidatum are adjuvants.Polygonum cuspidatum can promote blood circulation and remove blood stasis, clear away heat and dampness; Fengwei grass can relieve dampness and swelling. The whole prescription has the effect of Tonifying the spleen and kidney, promoting blood circulation and removing blood stasis, diuresis and detumescence.

According to the different manifestations of symptoms, the clinical application of Shenqi Zhilong Decoction on the basis of addition and subtraction in the treatment of qi deficiency and blood stasis Mn and idiopathic Mn has achieved good curative effect [11-12].Previous pharmacological studies have shown that the therapeutic effect of Shenqi Zhilong Decoction on Mn rats is related to the down regulation of renal tissue transforming growth factorβ1(Transforming growth factor-β1,TGF-β1) It is related to the expression level of heparanase 1 (HPA-1), so as to improve the pathological changes of renal glomerular foot process [13]. In this experiment, by establishing the mouse Mn model and observing the effect of Shenqi Zhilong Decoction on nephrin-podocin-neph1 receptor complex and ERK / cPLA2 pathway in kidney, we further explore the specific molecular mechanism of Shenqi Zhilong Decoction in the treatment of Mn, so as to provide scientific basis for clinical medication.

2. Materials and methods

2.1 Medicine

The decoction pieces of Shenqi Zhilong Decoction (Codonopsis pilosula, Astragalus membranaceus, leech, earthworm, Angelica sinensis, Ligusticum chuanxiong, Polygonum cuspidatum, stiff silkworm, epimedium and Fengwei grass) were purchased from the First Affiliated Hospital of Heilongjiang University of traditional Chinese medicine. Tripterygium wilfordii polyglycoside tablets(Hunan Qianjin Xieli Pharmaceutical Co, Ltd., approval No. gyzz z43020138, specification: 10 mg / tablet).

2.2 Animal

60 ICR mice of SPF grade, half male and half female, 6 weeks old, with a body mass of (23±4) g, were purchased from Liaoning Changsheng Biotechnology Co, Ltd., animal production certificate No.scxk (Liao) 2020-0001. Animal use license No.scxk (black)2018-003. The animal feeding environment is an animal room with constant temperature of 23-25℃, relative humidity of 50% ～ 55%and circadian rhythm of 12 hours, free drinking and eating. Adaptive feeding for one week. All animal experiments were approved by the animal ethics committee of Heilongjiang College of traditional Chinese medicine, No.: 201912014.

2.3 Reagent

Cationic bovine serum albumin (C-BSA) (American chondrex company, article number: 9058, specification: 20 mg); Complete Freund's adjuvant (American chondrex company, art. No.: 7008);Albumin (ALB), total protein (TP), creatinine (CRE), urea nitrogen(urea), cholesterol (CHO), triglyceride (TG) (Zhongsheng Beikong Biotechnology Co., Ltd., batch numbers 181511, 182512, 181401,183105, 182022 and 187831 respectively); Micro total protein determination kit (Germany Desai Diagnostic System Co., Ltd.,batch No.: 60137949); Beyofast SYBR green one step QRT PCR kit (Beijing biyuntian Technology Co., Ltd., Article No.:d7268m); Protease phosphatase inhibitor mixture (Beijing biyuntian Technology Co., Ltd., Article No.: p1051); IL-6, IL-4 and TNFαDetection kit (Nanjing Jiancheng Bioengineering Research Institute, batch No.: 20200326); Rabbit anti mouse p-cpla2 antibody(American affinity company, Article No.: af3329), Rabbit anti mouse cPLA2 antibody, p-ERK1 / 2 antibody and ERK1 / 2 antibody(Shenyang wanlei Biotechnology Co., Ltd., Article No.: wl02539,wlp1512 and wl01864); HRP labeled Goat anti rabbit IgG secondary antibody (Thermo Fisher Scientific, art. No.: 31490); Sumusu(Beijing solabao Technology Co., Ltd., Article No.: 517-28-2); Goat serum (Beijing solabao Technology Co., Ltd., Article No.: sl038);DAB (Maixin reagent company, Article No.: dab-1031).

2.4 Instrument

Puzs-600a automatic biochemical analyzer (Beijing planang New Technology Co., Ltd.); Cx23 optical microscope (Leica, Germany);Rm2235 slicer (Leica, Germany); Imark automatic enzyme labeling instrument (bio rad company of the United States); Rm2016 paraffin slicer (Leica Microsystems (Shanghai) Co., Ltd.); Amersham Imager 600 gel imaging system (GE, USA); Cp100nx ultra speed freezing centrifuge (HIMAC company of Japan).

2.5 Method

2.5.1 Drug preparationTake 20 g of Codonopsis pilosula, 15 g of Angelica sinensis, 30 g of Astragalus membranaceus, 5 g of leech (to be ground), 15 g of Ligusticum chuanxiong, 15 g of stiff silkworm, 20 g of earthworm,15 g of Polygonum cuspidatum, 15 g of phoenix tail grass and 30 g of epimedium, soak in 10 times of water for 1 h, decoct with fire for 1 h, filter and collect the liquid medicine. Add 10 times the amount of water to the drug residue, decoct for 1 hour, filter and collect the drug solution. After combining the filtrate twice, concentrate it to 1.2 g / ml. after sub packaging, freeze it in the refrigerator at - 80℃.

2.5.2 Preparation of membranous nephropathy modelReference literature methods to prepare model nephropathy mouse model [14]. The specific methods are as follows: after 3 days of adaptive feeding, the mice are randomly divided into blank control group (10) and model group (50). Cationic bovine serum albumin(C-BSA) (2 mg / ml, 10 ml PBS) was mixed with equal volume of Freund's complete adjuvant to prepare emulsion. Mice were injected subcutaneously with 0.2 ml of the prepared emulsion (C-BSA:0.2 mg) at multiple points at the tail root and groin for primary immunization. After 2 weeks, the model mice were injected with 100% by tail vein for the first timeμg (C-BSA: 0.1 mg / ml, Volume 1 ml), injected every other day, and the injection dose was increased to 300μg (C-BSA: 0.3 mg / ml, Volume 1 ml), injected 3 times a week for 4 weeks. After modeling, the 24h urinary protein value was measured, which was greater than 8 g / L. it was a successful mouse model.

2.5.3 Animal grouping and administrationAccording to the urinary protein value, the mice with successful modeling are randomly divided into model group, Shenqi Zhilong Decoction low-dose and high-dose groups (12 and 24 crude drugs/kg, calculated according to the total amount of crude drugs;according to the body surface area conversion algorithm, they are 0.5 and 1 times of human clinical equivalent dose respectively) and Tripterygium glycoside tablet group (14 mg / kg, 1 time of human clinical equivalent dose). The mice in the blank group were given equal volume distilled water once a day for 4 weeks.

2.5.4 Determination of blood biochemical indexesAfter the last administration, the eyeballs of mice in each group were taken for blood. After anticoagulation with heparin sodium,centrifuged at 3000 R·min-1 for 10 minutes at low temperature,separated the plasma, and measured the contents of TG, TC, TP,ALB, CRE, UA and urea by automatic biochemical analyzer.Serum IL-6, IL-4 and TNF were measured by automatic enzyme labeling instrument according to the instructions of enzyme-linked immunosorbent assay kit-α Content.

2.5.5 Determination of urinary protein

One day before the last administration, the urine of mice in each group was collected in the metabolic cage for 24 hours, and the urinary protein value was measured by pyrogallol red colorimetry with automatic biochemical analyzer.

2.5.6 HE staining of kidneyOne hour after the last administration, the mice in each group were anesthetized by intraperitoneal injection of 5% chloral hydrate (0.7 mL/100 g). The mouse kidney tissues were aseptically isolated and immediately fixed in 4% paraformaldehyde buffer overnight. After the gradient concentration ethanol is dehydrated step by step, the liquid paraffin is added dropwise, and the wax block is made after cooling. Slicer manual slicing, thickness of 5 μ m。Dye according to the instructions of the kit and observe under the light microscope.

2.5.7 Immunohistochemical staining of kidney

Mouse kidney tissues were aseptically isolated and fixed in 4%paraformaldehyde buffer overnight. Cut the wax block of kidney tissue into 4 pieces with a slicer μm thick slice, after baking, put it into the solution containing xylene for dewaxing, dehydrate with gradient concentration alcohol, and then repair the antigen with citric acid buffer. After incubation with 3% hydrogen peroxide, 10%normal goat serum was blocked at room temperature. First antibody incubation, second antibody incubation, DAB color development,hematoxylin re staining, finally dehydration, transparency and sealing, observe the slicing effect under the microscope and take photos.

2.5.8 RT-PCR was used to detect the expression of nephrin-1, nephrin and podocin in renal tissueTake out the frozen tissue from the refrigerator at - 80 ℃, weigh 500 mg of tissue into the mortar, pour a small amount of liquid nitrogen into the mortar, grind it into fine powder, transfer it to a 1.5ml centrifuge tube without RNase, add 1 ml Trizol lysate, mix well and stand for 10 minutes. Add 0.2 ml of chloroform, mix well for 10 s and stand for 5min. At 4 ℃, 12000 R / min, after centrifugation for 10min, the mixed liquid is divided into three layers, namely colorless aqueous phase, intermediate layer and yellow organic phase, and the aqueous phase is transferred to a new centrifuge tube. Add isopropanol in the same volume as water,mix well, and place it at - 20℃ overnight. After 15h, centrifuge at 10000 R / min for 10min and discard the supernatant. Add 1 ml of 75% ethanol to clean the precipitate. Centrifugation at 3400 R / min at 4℃ for 3min. after discarding the supernatant, place it at room temperature for 5 min to let the residual ethanol volatilize. Plus 3μL ddH2O without RNase is fully mixed and completely dissolved after precipitation, which is the total RNA of kidney tissue sample.After determining the RNA concentration, according to beyofast SYBR green one step QRT PCR kit. Reverse transcription reaction and PCR reaction were performed on the total RNA extracted from kidney tissue. The primer sequences are as follows: neph-1, upstream primer: acctgtcgcagtatgatga, downstream primer: ccacctgtagccaagat;Nephrin upstream primer: actatgccctcttcaaatgc, downstream primer:ctcacgcctcacaaccttca; Podocin upstream primer: aggatggctgagatt,downstream primer: tggtttggaggaacttgg; β-Actin upstream primer:ctgtgcccatctacgagggctat, downstream primer: tttgatgtcacgcatttcc. The relative expression of the target gene was 2- ΔΔ CT.

2.5.9 The expression of ERK and cPLA2 protein in renal tissue was detected by Western blotWeigh 500 mg of frozen kidney tissue into a mortar, pour a small amount of liquid nitrogen into the mortar, grind it into fine powder,transfer it to a 1.5ml centrifuge tube, and add 1ml of reinforced Ripa lysate (including 1 ml) × Protein phosphatase inhibitor), lysed in ice bath for 30 min, centrifuged at low temperature of 12000g for 10 min, and collected the total protein extract of supernatant. After the protein was quantified and denatured, the kit was prepared according to the SDS-PAGE gel. The electrophoresis was carried out, followed by wet transfer and sealing. Add p-ERK1 / 2 (1:1500),ERK1 / 2 (1:1500), p-cpla2 (1:2000), cPLA2 (1:1500) and β- Actin(1:2000) primary antibody diluent was incubated at 4 ℃ overnight.The next day, take out the NC membrane after incubating the primary antibody, wash it in tbst for 5min for three times, dilute the secondary antibody in proportion with tbst, and incubate it at room temperature for 2h. Immerse the incubated NC membrane into tbst for cleaning for 5min for 3 times. Then add the configured ECL luminescent reagent and keep it away from light at room temperature for standby. Exposure imaging, the results of Image J gel image processing software to analyze the gray value of the target strip.

2.5.10 Statistical methodsThe data were expressed by mean ± standard deviation (± s), and SPSS 18.0 software was used for one-way ANOVA. P ＜ 0.05 had significant difference, indicating that it was statistically significant.

3. Results

3.1 Effect of Shenqi Zhilong Decoction on UTP and liver function in MN mice

It can be seen from table 1 that compared with the blank group, the UTP value of mice in the model group increased significantly (P＜ 0.01). Compared with the model group, after administration, the UTP value of mice in Shenqi Zhilong Decoction low-dose group,high-dose group and Tripterygium glycoside tablet group decreased significantly (P ＜ 0.01). In addition, compared with the blank group,the contents of ALB and TP in the model group were significantly lower (P ＜ 0.01). Compared with the model group, the contents of TP and ALB in the low-dose and high-dose groups of Shenqi Zhilong Decoction were significantly higher (P ＜ 0.05, P ＜ 0.01);The content of TP in Tripterygium wilfordii polyglycoside tablet group increased significantly (P ＜ 0.05), but had no effect on the content of Alb (P ＞ 0.05).

3.2 Effect of Shenqi Zhilong Decoction on renal function of MN mice

As can be seen from table 2, compared with the blank group, there was no significant change in the contents of CRE, urea and UA in the model control group (P ＞ 0.05). Compared with the model group, the contents of CRE, urea and UA in low-dose and high-dose Shenqi Zhilong Decoction groups had no significant change (P ＞0.05); CRE increased significantly (P ＜ 0.05) and urea decreased significantly (P ＜ 0.01) in Tripterygium wilfordii polyglycoside tablet group.

3.3 Effect of Shenqi Zhilong Decoction on blood lipid in MN mice

Table 1 Effects of Shenqi Zhilong Decoction on UTP and liver function in MN mice(±s,n=10)

Table 1 Effects of Shenqi Zhilong Decoction on UTP and liver function in MN mice(±s,n=10)

Note: Compared with the blank group, * P ＜ 0.05, ** P ＜ 0.01; Compared with the model group, #p ＜ 0.05, ##p ＜ 0.01.

Group Dose UTP(g/L) ALB(g/L) TP(g/L)Blank group - 3.18±0.63 23.77±5.91 51.89±3.11 Model group - 16.28±4.34** 18.34±3.35** 48.28±2.63**Shenqi Zhilong Decoction low dose group 12 g/kg 9.17±3.41## 23.52±6.58# 53.47±1.55##Shenqi Zhilong Decoction high dose group 24 g/kg 7.94±2.85## 24.48±4.68## 53.11±1.66##Tripterygium wilfordii polyglycoside group 0.014 g/kg 7.06±2.23## 19.58±6.71 51.77±4.25#Fvalue 76.512 47.631 95.775 Pvalue 0.000 0.000 0.000

Table 2 Effect of Shenqi Zhilong Decoction on renal function indexes of MN mice(±s,n=10)

Table 2 Effect of Shenqi Zhilong Decoction on renal function indexes of MN mice(±s,n=10)

Note: Compared with the blank group, * P ＜ 0.05, ** P ＜ 0.01; Compared with the model group, #p ＜ 0.05, ##p ＜ 0.01.

Group Dose CRE(μmol/L) UREA(μmol/L) UA(μmol/L)Blank group - 33.82±7.40 6.09±1.51 121.93±17.81 Model group - 32.79±7.28 6.05±1.12 120.78±36.71 Shenqi Zhilong Decoction low dose group 12 31.66±5.24 5.80±1.97 119.37±18.75 Shenqi Zhilong Decoction high dose group 24 31.29±6.27 5.82±1.71 121.25±22.47 Tripterygium wilfordii polyglycoside group 0.014 38.78±4.41# 5.31±0.42## 120.65±31.53 Fvalue 13.154 5.841 1.251 Pvalue 0.035 0.024 0.654

It can be seen from table 3 that compared with the blank group,the contents of small CHO and TG in the model control group increased significantly (P ＜ 0.05). Compared with the model group,the content of CHO in Shenqi Zhilong Decoction low-dose group,high-dose group and Tripterygium glycoside tablet group decreased significantly (P ＜ 0.05); The content of TG in the low-dose and highdose groups of Shenqi Zhilong Decoction decreased significantly (P＜ 0.05), but there was no significant change in the content of TG in the Tripterygium glycoside tablet group (P ＞ 0.05).

Table 3 Effect of Shenqi Zhilong Decoction on blood lipid in MN mice(±s,n=10)

Table 3 Effect of Shenqi Zhilong Decoction on blood lipid in MN mice(±s,n=10)

Group Dose CHO(mmol/L) TG(mmol/L)Blank group - 2.60±0.67 1.02±0.24 Model group - 3.39±0.89* 1.40±0.29*Shenqi Zhilong Decoction low dose group 12 2.68±0.56# 1.16±0.12#Shenqi Zhilong Decoction high dose group 24 2.61±0.43# 1.10±0.36#Tripterygium wilfordii polyglycoside group 0.014 2.70±0.46# 1.20±0.23 Fvalue 71.254 50.257 Pvalue 0.002 0.009

3.4 Effect of Shenqi Zhilong Decoction on renal pathological changes in MN mice

As can be seen from Figure 1, the size of glomerular mesangium and lumen in the blank group were normal. In the model group,the glomerulus was lobulated, the glomerular mesangium was thickened, the lumen was enlarged, the renal capsule wall epithelium was damaged, and the number of cells decreased. Compared with the model control group, the glomerular mesangial thickening,lumen expansion and epithelial damage of mice in Shenqi Zhilong Decoction low-dose group, high-dose group and Tripterygium glycoside tablet group were significantly reduced, and the number of cells tended to be normal, among which the Shenqi Zhilong Decoction high-dose group was the best.

In addition, the expression of IgG in the kidney of mice in the blank group was negative, that is, there was no IgG deposition. The expression of IgG in the model group increased significantly, that is, there was a large amount of IgG deposition. Compared with the model group, the expression of IgG in mice and even tissues of Shenqi Zhilong Decoction low-dose group, high-dose group and Tripterygium glycoside tablet group decreased significantly, that is,the deposition of IgG decreased, and the high-dose Shenqi Zhilong Decoction group was the best.

3.5 Effect of Shenqi Zhilong Decoction on serum IL-6, IL-4 and TNF in Mn mice ffect of content

It can be seen from table 4 that compared with the blank group,the serum IL-6, IL-4 and TNF of mice in the model group-α The contents were significantly increased (P ＜ 0.01). Compared with the model group, the serum levels of IL-6, IL-4 and TNF in Shenqi Zhilong Decoction low-dose group, high-dose group and Tripterygium glycoside tablet group-αThe content of was significantly decreased (P ＜ 0.05, P ＜ 0.01).

Figure1 Effects of Shenqi Zhilong Decoction on renal pathological morphology and IgG expression in MN mice(×200)

Table 4 Effects of Shenqi Zhilong Decoction on serum IL-6, IL-4 and TNF in MN mice effect of content (±s,n=10)

Table 4 Effects of Shenqi Zhilong Decoction on serum IL-6, IL-4 and TNF in MN mice effect of content (±s,n=10)

Note: Compared with the blank group, * P ＜ 0.05, ** P ＜ 0.01; Compared with the model group, #p ＜ 0.05, ##p ＜ 0.01.

Group Dose IL-6(ng/L) IL-4(ng/L) TNF-α(ng/L)Blank group - 105.62±7.92 57.77±11.19 11.16±7.66 Model group - 125.74±18.06** 80.32±12.57** 105.64±31.25**Shenqi Zhilong Decoction low dose group 12 110.39±10.65# 67.33±10.44# 73.16±27.71#Shenqi Zhilong Decoction high dose group 24 105.73±11.59## 65.84±10.34# 68.81±25.17##Tripterygium wilfordii polyglycoside group 0.014 102.60±16.43## 64.89±11.54# 67.85±26.44##Fvalue 22.367 29.574 135.153 Pvalue 0.000 0.000 0.000

Table 5 Effect of Shenqi Zhilong Decoction on ERK / cPLA2 signaling pathway in MN mice(±s,n=10)

Table 5 Effect of Shenqi Zhilong Decoction on ERK / cPLA2 signaling pathway in MN mice(±s,n=10)

Note: Compared with the blank group, * P ＜ 0.05, ** P ＜ 0.01; Compared with the model group, #p ＜ 0.05, ##p ＜ 0.01.

Group Dose Relative expression p-ERK1/2/ ERK1/2 ERK1/2/β-actin p-cPLA2/cPLA2 cPLA2/β-actin Blank group - 0.22±0.06 0.41±0.05 0.21±0.02 0.59±0.03 Model group - 0.92±0.08** 0.39±0.04 0.99±0.06** 0.57±0.05 Shenqi Zhilong Decoction low dose group 12 0.53±0.09## 0.41±0.07 0.81±0.06## 0.60±0.04 Shenqi Zhilong Decoction high dose group 24 0.36±0.08## 0.40±0.08 0.21±0.09## 0.60±0.03 Tripterygium wilfordii polyglycoside group 0.014 0.37±0.06## 0.41±0.03 0.29±0.03## 0.57±0.04 Fvalue 64.245 1.264 45.126 1.147 Pvalue 0.000 0.234 0.000 0.341

Table 6 Effect of Shenqi Zhilong Decoction on the expression of Nephrin, Podocin and Neph1 in visceral tissue of MN mice(±s,n=10)

Table 6 Effect of Shenqi Zhilong Decoction on the expression of Nephrin, Podocin and Neph1 in visceral tissue of MN mice(±s,n=10)

Note: Compared with the blank group, * P ＜ 0.05, ** P ＜ 0.01; Compared with the model group, #p ＜ 0.05, ##p ＜ 0.01.

Group Dose Relative expression Nephrin Podocin Neph-1 Blank group - 1.00±0.04 1.00±0.05 1.00±0.06 Model group - 0.28±0.05** 0.19±0.04** 0.22±0.02**Shenqi Zhilong Decoction low dose group 12 0.52±0.05## 0.41±0.07## 0.58±0.11##Shenqi Zhilong Decoction high dose group 24 0.75±0.04## 0.68±0.03## 0.85±0.11##Tripterygium wilfordii polyglycoside group 0.014 0.77±0.05## 0.66±0.06## 0.81±0.09##Fvalue 141.58 214.025 132.015 Pvalue 0.000 0.000 0.000

3.6 Effect of Shenqi Zhilong Decoction on ERK / cPLA2 signaling pathway in MN mice

It can be seen from table 5 and Figure 2 that compared with the blank group, the expression of p-ERK1 / 2 and p-cpla2 protein in the kidney of model group mice increased significantly (P ＜ 0.01),and the expression of cPLA2 and ERK1 / 2 protein did not change significantly (P ＞ 0.05). Compared with the model group, the expression of p-cpla2 and p-ERK1 / 2 protein decreased significantly in Shenqi Zhilong Decoction low dose, high dose and Tripterygium glycoside tablet groups (P ＜ 0.05, P ＜ 0.01), and there was no significant change in the expression of cPLA2 and ERK1 / 2 protein(P ＞ 0.05).

Figure 2 Effect of Shenqi Zhilong Decoction on ERK / cPLA2 signaling pathway in MN miceA:Control group; B: Model group; C: Shenqi Zhilong Decoction low dose group; D: Shenqi Zhilong Decoction high dose group; E: Tripterygium wilfordii polyglycoside group

3.7 Effect of Shenqi Zhilong Decoction on the expression of nephrin, podocin and NEPH1 in kidney of MN mice

It can be seen from table 6 that compared with the blank group, the expression of nephrin, podocin and NEPH1 mRNA in the kidney tissue of mice in the model group decreased significantly (P ＜ 0.01).Compared with the model control group, the expression of nephrin,podocin and NEPH1 mRNA in the kidney tissue of mice in the lowdose and high-dose Shenqi Zhilong Decoction and Tripterygium glycoside tablet groups increased significantly (P ＜ 0.01).

4. Discussion

The MN mouse model induced by cationic bovine serum albumin(C-BSA) is one of the widely used models [15]. CBSA can combine positively charged cations with anionic sites on the glomerular basement membrane to form immune complexes, which are deposited on the basement membrane, resulting in the destruction of glomerular filtration barrier and a large amount of proteinuria [16].The results show that Shenqi Zhilong decoction can significantly reduce the quantitative value of urinary protein, increase the level of serum albumin and reduce the levels of CHO and TG in Mn mice,indicating that Shenqi Zhilong decoction has a certain protective effect on the destruction of glomerular filtration barrier.

The glomerular filtration barrier is composed of capillary endothelium, basement membrane and fissure membrane, and fissure membrane proteins (such as nephrin, podocin and NEPH1)are the key to ensure the function of glomerular filtration barrier[17-18]. Nephrin, a member of the immunoglobulin family, is a transmembrane protein consisting of a short intracellular domain and connected with eight distal IgG like motifs and one Ш The extracellular domain of type I connexin like motif is specifically expressed in glomerulus and plays an important role in maintaining the selective permeability of glomerular barrier [19-20]. Podocin is a member of stomatal protein family. Its C-terminal domain can be combined with the cytoplasmic part of nephrin. It can inhibit podocyte apoptosis through the activation of PI3K / Akt signaling pathway mediated by the interaction with CD2AP [21-22]. NEPH1 is a member of the transmembrane protein NEPH1 family. Through the interaction of intracellular domains, NEPH1 and NEPH1 conduct complex signals from outside to inside and induce actin aggregation on the plasma membrane [23]. As transmembrane receptors of the septum, nephrin, podocin and nephrin constitute the nephrin-podocin-nephrin receptor complex. Mutation or loss of genes encoding these proteins will lead to the occurrence of human nephrotic syndrome [24-25]. The results of this study show that compared with the blank control group, Shenqi Zhilong decoction can significantly increase the expression levels of nephrin, podocin and NEPH1 genes in Mn mice, indicating that Shenqi Zhilong decoction can protect glomerular filtration barrier by regulating the expression of related genes of nephrin-podocin-neph1 receptor complex.

MN is due to the deposition of immune complexes formed by antigens and antibodies under the glomerular visceral epithelium and the activation of complement formation membrane attack complex (C5b-9), resulting in the injury of glomerular epithelial cells (GEC), podocyte dysfunction and the loss of glomerular barrier function, resulting in proteinuria [26]. Cytoplasmic phospholipase A2 (cPLA2) is a highly conserved lipid modifying enzyme, which cleaves arachidonic acid from glycerol phospholipids by catalyzing the hydrolysis bond at the sn-2 position, thereby increasing the intracellular ca2+ concentration. It is an important mediator of C5b-9 dependent GEC damage [27-28]. ERK signaling pathway is activated after ERK1 / 2 double site Ser / Thr is phosphorylated. ERK signaling pathway can promote the phosphorylation of cytoplasmic target proteins. Among them, cPLA2 is one of the main targets of ERK phosphorylation. Therefore, the activation of ERK signaling pathway can also lead to the activation of cPLA2 [29]. The activation of ERK1 / 2 signaling pathway can promote TNF-α Secretion of proinflammatory factors [30]. In addition, GEC injury can secrete proinflammatory cytokines, thereby aggravating the inflammatory response [31]. The results showed that in Shenqi Zhilong Decoction group, the basement membrane was significantly thickened and the enlargement of renal capsule was reduced; It can significantly inhibit the expression of p-ERK1 / 2 and p-cpla2 protein; Reduce IL-6, IL-4 and TNF in plasma- α Content, indicating that Shenqi Zhilong decoction can reduce GEC injury and reduce the secretion of proinflammatory cytokines by inhibiting the activation of ERK /cPLA2 pathway.

In conclusion, Shenqi Zhilong decoction has a good therapeutic effect on Mn mice. Its mechanism is related to regulating the expression of genes related to nephrin-podocin-neph1 receptor complex, protecting glomerular filtration barrier, inhibiting the activation of ERK / cPLA2 pathway, reducing the injury of glomerular epithelial cells and reducing the secretion of proinflammatory cytokines.

Author's contribution

The experiment was designed and operated by Xue piliang. Xu Meixiu and Li Xingyu were responsible for the index detection. Li Liqi and Xu Meixiu analyzed the experimental data. The article was written by Xue piliang and finally reviewed by Wang Shun. The above authors have no conflict of interest in the article.