SHAO Yina, WANG Jiahao, ZHANG Yi, and LI Chenghua,

1) State Key Laboratory for Managing Biotic and Chemical Threats to the Quality and Safety of Agro-Products,Ningbo University, Ningbo 315211, China

2) Laboratory for Marine Fisheries Science and Food Production Processes, Qingdao National Laboratory for Marine Science and Technology, Qingdao 266071, China

Abstract F-type lectins (Fucolectins) are carbohydrate-binding proteins and play important roles in innate immune responses against pathogenic microbial invasion. In our previous research, we found that two homologous Fucolectin genes, AjFTL-1 and AjFTL-2, exhibited different expression profiles after lipopolysaccharides (LPS) challenge in Apostichopus japonicus. However, the transcriptional regulation mechanism of these two genes remains largely unknown. In this study, the 5’ flanking regions of AjFTL-1 and AjFTL-2 genes were cloned and the promoter activities were studied in epithelioma papulosum cyprinid (EPC) cell system. First,in silico analysis indicated that these two promoters both contain numerous putative transcription factor binding sites including NF-κB, CREB, and CREBP1, and both contain a TATA box. Additionally, luciferase assay and progressive 5’ truncation analysis revealed that AjFTL-1 and AjFTL-2 both possess high promoter activities in EPC cells. Moreover, the luciferase activity of AjFTL-1 promoter was significantly regulated by peptidoglycan (PGN) and mannan (MAN), while AjFTL-2 promoter was prominently regulated by LPS and MAN, indicating AjFTL-1 and AjFTL-2 genes showed different transcriptional regulation pattern under different immune stimulation. More importantly, analyses of the functional promoter regions revealed the presence of two potential NF-κB binding sites (?769 bp to ?761 bp, ?185 bp to ?172 bp) in AjFTL-1 and one potential binding site (?530 to ?517 bp) in AjFTL-2. Different truncated reporter vectors and expression vector co-transfection revealed that transcription factor NF-κB/Rel could significantly increase the AjFTL-2 promoter activity, but not AjFTL-1 promoter activity. These findings indicated that in marine invertebrates, different Fucolectin members differ in transcription regulations and expression patterns, and might play different roles in immune defenses during pathogen infection.

Key words Apostichopus japonicus; Fucolectin promoter; genome structure; transcription factor; luciferase assay

1 Introduction

The sea cucumberApostichopus japonicusis one of the most economically important species in aquaculture (Hanet al., 2016). Since 2003, large-scale deaths ofA. japonicusoccured in China because of disease outbreaks, especially the skin ulceration syndromes, which has caused catastrophic losses to aquaculture industry (Liuet al., 2010).At present, there is still no method to control pathogenic diseases. However, understanding the immune response of sea cucumbers to pathogens may provide a better knowledge about the immune defense mechanisms and ultimately lead to the development of disease management strategy in sea cucumber farming.

Like other invertebrate species, sea cucumbers exclusively rely on innate immune responses against pathogenic microbes’ invasion (Beutler, 2004; Milutinovi?et al.,2016). After infection, the early recognition of a pathogen depends on pattern recognition receptors (PRRs), which serve as the first line of internal defense (Medzhitovet al.,2002; Ghoshet al., 2011). PRRs can recognize and bind the specific carbohydrate moieties of pathogen associated molecular patterns (PAMPs) on the surface of microorganisms through carbohydrate recognition domains (CRD)(Medzhitovet al., 2002; Gulatiet al., 2019). Lectins are a number of carbohydrate-binding proteins playing key roles in immune recognition and are considered to be important PRRs (Tatenoet al., 2001; Vastaet al., 2011). According to their primary structure of CRDs and cation requirements, lectins are divided into at least seven families (Fujitaet al., 2004), such as C-type lectin, galectin, C-reactive protein. Recently, F-type lectin (Fucolectin) has been recognized as a novel immune-recognition molecule that has a function in immune surveillance (Hondaet al., 2000;Bishnoiet al., 2015).

Fucolectin that binds fucose and shares a characteristic fucose binding motif has been described in both vertebrates (Odomet al., 2006) and invertebrates (Chenet al.,2011). A large number of studies have indicated that Ftype lectins exhibit diverse functions, such as mediating immune recognition (Bianchetet al., 2002), recognizing microbial pathogenesis (Borastonet al., 2006), creating fertilization envelope (Springeret al., 2008), promoting agglutination (Khanet al., 2002) and so on. InSparus aurata, an identified SauFBP protein shows opsonic activity to enhance phagocytosis by peritoneal macrophages(Cammarataet al., 2012). InAnguilla anguilla, there are at least seven isoforms of Fucolectins in European eel serum with different functions. Among them, some Fucolectins can agglutinate human erythrocytes (Khanet al.,2002), whereas others can recognize and bind bacterial liposaccharides (Bianchetet al., 2002). In our previous study,two Fucolectin homologous genes,AjFTL-1andAjFTL-2,were cloned from sea cucumberA. japonicusand found to be both up-regulated afterVibrio splendidusinfection;however, lipopolysaccharides (LPS) stimulationin vitrocould only induceAjFTL-2transcription, not that ofAjFTL-1(Shaoet al., 2018). Moreover, Parket al. (2012)indicated that the mRNA expressions ofRbFTL-1andRbFTL-2inOplegnathus fasciatuswere also differentially regulated after different pathogen infections, suggesting Fucolectin family members might respond to the pathogens with different mechanisms. Unfortunately, the detailed transcription regulation mechanism of Fucolectin genes are poorly understood. Understanding the transcription regulation of these molecules may help to understand the immune defense and control the disease outbreaks.

It is well known that the function of a promoter is to control the transcription of a downstream gene (Werner,1999). Therefore, studying the structure and function of a promoter is the important way to know how the gene regulates its transcription and starts its expression. So far,promoter functions analysis has been conducted in most types of lectins (Laiet al., 2013; Kj?rupet al., 2014; Wuet al., 2018). Laiet al. (2013) indicated that a promoter of C-type lectin inFenneropenaeus chinensiscould be significantly induced by heat shock and white spot syndrome virus challenge. Tanjiet al. (2008) demonstrated that the transcription ofSarcophagaperegrinalectin was regulated by multiple NF-κB binding motifs in its promoter.Most studies have revealed that NF-κB homologies act as transcription factors and bind to the promoter regions of various lectin genes (Engstr?m, 1999; Liet al., 2015).However, little is known about the regulation mechanism of Fucolectin gene expression, particularly in invertebrate species. To better understand how theAjFTLgenes are regulated can provide more information for bacterial disease control. In this study, the genomic structure and promoter ofAjFTL-1andAjFTL-2were cloned from sea cucumber, and the transcriptional regulation mechanism of these two genes were assessed in epithelioma papulosum cyprinid (EPC) cells.

2 Materials and Methods

2.1 Animals

The adult sea cucumberA. japonicus(weight 150 g ± 15 g)were obtained from Dalian Pacific Aquaculture Company(Dalian, China). After a temporary rearing, sea cucumber coelomocytes were collected with sterile syringe, and centrifuged at 800 ×gfor 5 min for genomic DNA preparation.

2.2 Cloning of Promoter Region of AjFTL-1 and AjFTL-2 Genes by Genome Walking

Genomic DNA was isolated from the sea cucumber coelomocytes with the TIANamp Marine Animals DNA Kit(Beijing, China). The 5’ flanking regulatory region ofAjFTL-1andAjFTL-2were both obtained using a Genome WalkerTMUniversal Kit (Clontech, USA) according to the manufacturer’s instruction. Briefly, four libraries of DNA fragments were prepared by digestion of sea cucumber coelomocytes genomic DNA with the restriction enzymes DraI, EcoRV, PvuII and StuI. Furthermore, two reverse specific primers (Table 1) were designed based on the target genes ofAjFTL-1andAjFTL-2(Shaoet al., 2018), and used in nested PCRs for per library in combination with the forward Adaptor primers AP1 and AP2 (Table 1), respectively. The desired PCR products were purified and further cloned into the pMD19-T simple vector (TaKaRa,Japan) for sequencing (Sangon, China). To verify the obtained sequences ofAjFTL-1andAjFTL-2, PCR was performed with designed primers of the 5’ flanking region and cDNA region (Table 1), while genomic DNA was used as template. The potential transcription factor binding sites were identified through TFBIND software (http://tfbind.hgc.jp/).

Table 1 Primers used in this study

Primer name Primer sequence (5’–3’) Used for AjFTL-2 ZF ATTATGCTACTGGCACAACGAT AjFTL-2 ZR GGATGCTCCGACAAGCAGACAAG Promoter check F1(?792/+23) GGTACCTGCGGTGGTGTCCTCATACTAAA F1(?750/+23) GGTACCTGCGGTGGTGTCCTCATACTAAA F1(?700/+23) GGTACCTGTAACAGTGGAAGATTAGG F1(?602/+23) GGTACCGTCAACCCGTTCCGTCAACTTCG F1(?529/+23) GGTACCAATGTTCCATAACCTAGGC F1(?479/+23) GGTACCATGAATGTTAGTATTGTTGGT F1(?400/+23) GGTACCAATTTGTGGTTAGTCTTA F1(?275/+23) GGTACCTGCAATCTTCATATGCAC F1(?154/+23) GGTACCTTGGAATCACGGGCGATCGG F1(?72/+23) GGTACCCATAGTTTGTTCTTTATAGAT R1(+23) AAGCTTAGAACCTCATTTTTCTGAGGAAT F2(?653/+41) GGTACCATTATGCTACTGGCACAACGAT F2(?589/+41) GGTACCCCTTAATTTGGTTCACTTC F2(?510/+41) GGTACCATGAATGTTAGTATTGTTG F2(?434/+41) GGTACCTTTCGAGTTGACTTGGGTGTA F2(?346/+41) GGTACCCTCACACTGCTCAATATTTAA F2(?253/+41) GGTACCTGGGAGGTATTCAGCTTTGA F2(?89/+41) GGTACCCAGGTATTTTTCTGGCTTA R2(+41) AAGCTTCATGTCAAGAACATCATCTTTCT Promoter activity AjRel F AAGCTTGGATGGATTCAGAGCCTGCAATTCC AjRel R CTCGAGTCAATCCAAAAAATCAGACTGGC Transcription factor M13 F GTCGTGACTGGGAAAACCCTGGCG M13 R GAGCGGATAACAATTTCACACAGG Sequencing

2.3 Plasmid Constructions

To analyze theAjFTL-1andAjFTL-2basal promoter activities, ten and seven truncated promoter fragments of these two genes were generated by PCR and cloned into the pGL3-Basic luciferase reporter vector (Promega, USA)atKpnI/HindIII sites with T4 DNA ligase (TaKaRa, Japan), respectively. All of these plasmids were sequenced to validate their correctness and each plasmid DNA for transfection was purified with an E.Z.N.A.? Plasmid Mini Kit (OMEGA, USA).

2.4 Generation of Expression Vectors for NF-κB/Rel

To analyze whether these two genes were regulated by NF-κB/Rel, the full-length cDNA ofNF-κB/Rel(GenBank accesion No. JF828765.1)from sea cucumber was cloned with specific primers (Table 1), digested withHindIII andXhoI, then ligated into the expression vector pCMV-Flag 2C (Promega, USA). The plasmid was sequenced and prepared with endotoxin-free Plasmid Kit (OMEGA, USA).It has been confirmed by western blot in our previous study that the expression vector successfully expressed in the luciferase assay experiment (Shaoet al., 2016).

2.5 Functional Characterization of the AjFTL-1 and AjFTL-2 Promoters Using an EPC Cell System

The epithelioma papulosum cyprinid (EPC) cells were cultured at 28℃ in Leiboviz’s L-15 medium (Invitrogen,USA) containing penicillin (100 U mL?1) and streptomycin sulfate (100 mg mL?1) and supplemented with 10%fetal bovine serum (FBS). For plasmid transfection, 2 ×104cells per well were seeded in a 96-well plate with 100 μL medium. At a density of 80% confluence, the cells were co-transfected with 0.2 μg of serial reductions of promoter reporter plasmids or 2 ng of plasmid pRL-TK (the internal control) using 0.4 μL of the Fugene?HD transfection reagent (Promega, USA) for 24 h. Meanwhile, the empty pGL3-Basic reporter vector was used as the negative control.

For three types of PAMPs challenges, the transfected cells with the longest promoter reporter plasmids of F1(?966/+23) and F2 (?831/+41) were changed to fresh medium at 12 h after transfection. Then, the cells were stimulated with lipopolysaccharide (LPS,Escherichia coli055:B5), peptidoglycan (PGN,Staphylococcus aureus), and mannan (MAN,Saccharomyces cerevisiae) under two concentrations (0.1 and 1 μg mL?1) for 24 h, respectively. The untreated cells were served as control.

To investigate the role of predicted transcription factor binding sites of NF-κB forAjFTL-1andAjFTL-2promote activities, the cells were co-transfected with 0.1 μg expression plasmid, 0.1 μg reporter plasmid, and 2 ng pRL-TK in each well. Co-transfection with 0.1 μg empty pCMVFlag 2C expression vector, 0.1 μg reporter plasmid, and 2 ng pRL-TK were used as control. After transfection, all cells were prepared for luciferase activity assays using Dual-luciferase reporter assay kit (Promega, USA).

2.6 Dual-Luciferase Reporter Assay

After transfection, the cell culture medium was discarded, the cells were washed two times in PBS, and all rinse solution was removed. Then the cells were mixed with 20 μL of 5 × Passive Lysis Buffer (PLB) and 20 μL of Luciferase Assay Reagent II (LAR II) to measure the firefly luciferase activity by GloMax 96, 20/20 luminometer (Promega USA). Finally, 20 μL of Stop & Glo?Reagent was added and the renilla luciferase activity was measured.Promoter activities were expressed as a ratio of firefly to renilla luciferase activities. All the data were obtained from three independent transfection experiments, and the final results are presented as average values ± standard deviations (SD). Differences were considered significant whenP＜ 0.05.

3 Results and Discussion

3.1 Genomic Structure and Promoter Region of AjFTL-1 and AjFTL-2

Fucolectins are known as PRRs and they play crucial roles in innate immunity (Vastaet al., 2011; Vastaet al.,2017). However, the promoter of the Fucolectin genes have not been studied in invertebrate species. To uncover the transcription regulation mechanism of F-type lectins, the genomic sequences and 5’ flanking regions of theAjFTL-1andAjFTL-2geneswere obtained using the genome walking method. First, we found that the sizes of genomic DNA ofAjFTL-1(GenBank accession no. MH086241) andAjFTL-2(GenBank accession no. MH086242) were 1055 bp and 656 bp in length, respectively (Fig.1). TheAjFTL-1gene includes six exons and five introns, while theAjFTL-2gene contains five exons and four introns. Although the pairwise sequence alignment of mature proteins showed that AjFTL-1 shared 87.4% identity with AjFTL-2 (Shaoet al., 2018), their exons exhibited significant differences.Liuet al. (2011) showed that the C-type lectins from grass carp share the same structure with their homologs,which is different with our results. We speculated that AjFTL-1 and AjFTL-2 might perform divergent functions during immune response.

Fig.1 Gene structure of AjFTL-1 and AjFTL-2. The yellow boxes indicate transcription initiation site. The white boxes indicate 5’-UTR and 3’-UTR. The blue boxes indicate regions encoding signal peptides. The green boxes indicate regions encoding mature peptides.

Furthermore, we obtained up-stream sequences from the TSS of theAjFTL-1andAjFTL-2with 792 bp and 653 bp,respectively (Fig.2). Sequence alignment between their promoter regions showed they are highly conserved. A number of transcription factor binding sites have been predicted in the promoter regions of bothAjFTL-1andAjFTL-2,such as the binding sites of NF-κB, STAT, Oct-1, CREB,CREBP1, and HSF-2. The CREB family proteins mainly function as an activator to regulate expression of genes involved in metabolism, inflammation, and signal transduction (Mayr and Montminy, 2001). CEBP proteins belong to the CCAAT/enhancer-binding protein (C/EBP) family. They are also known as stress-responsive transcription factors during DNA damage, cellular differentiation,and can respond to inflammatory stimulation (Lekstrom-Himeset al., 1998; Yanget al., 2017). Oct-1 is another transcription factor that regulates in a cell cycle-dependent manner and is essential for post-translational modification (Advaniet al., 2003). In our results, these immune-related transcription factors might play important roles in the regulation of these two Fucolectin genes transcription. However, further functional studies are necessary to determine whether these ubiquitous transcription factors involve in the regulation of Fucolectin gene transcription. Generally, the core promoters of mammalian proteincoding genes usually consist of a TATA box, which is 25–30 bp upstream of TSS (Quanet al., 2009). In our results,TATA boxes were found to be located between ?32 and?22 before the TSS in bothAjFTL-1andAjFTL-2.

3.2 Promoter Activities of AjFTL-1 and AjFTL-2 Carrying 5’ Truncation Analysis

Fig.2 Alignment of 5’ upstream regions of AjFTL-1 and AjFTL-2. The transcription start site is boxed and denoted as +1.Positions of potential binding sites for transcription factors are underlined. The overlapping binding sites are shaded. The start codon is blacked.

To identify the functional areas of the promoter regions ofAjFTL-1andAjFTL-2, a series of truncated promoter fragments were transfected into EPC cells (Fig.3). The EPC cell system has been extensively used as expression tool for function studies in marine invertebrates like shrimp(Dharet al., 2007), mud crab (Dinget al., 2013), as well as sea cucumber (Zhanget al., 2020). More importantly,as one of the echinoderm species, sea cucumbers is the transitional organism from invertebrate to vertebrate and is closer to cephochordata (Shuet al., 2004), so the vertebrate cell lines are more suited for verifying the transcriptional regulation and expressing invertebrate proteins like Echinodermata (Shiet al., 2016; Liuet al., 2020). Here,our results indicated that the promoter fragment F1 (?700/+23) ofAjFTL-1showed the highest activity (4.24-fold,P＜ 0.01) among all truncated fragments in EPC cells when compared with empty vector (Fig.3A), suggesting that the negative elements might be present in the fragment between F1 (?792/+23) and F1 (?700/+23). ForAjFTL-2promoter, the activities of the truncatedAjFTL-2promoter fragments of F2 (?653/+41), F2 (?589/+41), F2 (?510/+41), F2 (?434/+41), F2 (-346/+41), F2 (?253/+41), and F2 (?89/+41) were all markedly induced by 3.17-, 3.54-,4.64-, 3.86-, 3.41-, 3.72-, and 2.59-fold (P＜ 0.01) when compared with control, indicating theAjFTL-2promoter might be a stronger promoter (Fig.3B). Similar results were observed in the white spot syndrome virus WSSV108 promoter by Liuet al. (2015), which showed that the fragment of p (?100/+368) exhibited strong promoter activity. Moreover, Liet al. (2015) demonstrated that a 103 bp 5’ flanking promoter sequence of C-type lectin contains a conserved NF-κB binding motif and shows high luciferase activity. In our study, we speculated that there might be positive elements in the limited sequence which is in favor of the strong promoter activity forAjFTL-2.

Fig.3 Functional analysis of different regions of AjFTL-1 (A) and AjFTL-2 (B) promoters in transfected EPC cells. The data are expressed as fold increase relative to empty vector (pGL3-Basic), and values are given as mean ± SD (n = 3). Asterisks indicate significant differences: *P ＜ 0.05, **P ＜ 0.01.

3.3 Promoter Activities of AjFTL-1 and AjFTL-2 Are Regulated by Three PAMPs

Fucolectins are sugar-binding proteins that can recognize pathogens under infection. In our previous work, we detected that the mRNA expression ofAjFTL-2was significantly increased after LPS stimulationin vitro, but the expression ofAjFTL-1wasn’t affected significantly (Shaoet al., 2018). Moreover, Wanget al. (2018) indicated that another isoform of Fucolectin fromA. japonicuscan bind LPS, PGN, and MAN, respectively. LPS, a major component of Gram-negative bacteria, plays a crucial role in stimulating the immune and inflammatory responses of the hosts (Rietschelet al., 1994; Alexanderet al., 2001). PGN is a cell wall component of almost all Gram-positive bacteria that can stimulate strong immune activity (Fenget al.,2007), and MAN is a major structural component of the yeast cell walls (Ogawaet al., 1994). To test whether the different isoforms of Fucolectins in sea cucumber are specific to pathogen recognition, the F1 (?792/+23) and F2(?653/+41) reporter vectors were transfected to EPC cells and stimulated with these three types of PAMPs using luciferase reporter system (Fig.4). In our study, the luciferase activity in EPC cells transfected with theAjFTL-2promoter of F2 (?653/+41) was significantly increased by 1.62-fold (P＜ 0.01) under 1 μg mL?1LPS treatment for 24 h, but the activity ofAjFTL-1transfectant was not affected significantly with the same treatments. However, the activity ofAjFTL-1transfectant was significantly increased by 1.60-fold (P＜ 0.05) after 1 μg mL?1PGN treatment, whileAjFTL-2promoterdid not show significant change with 0.1 or 1 μg mL?1PGN stimulation. From these results, we concluded that bothAjFTL-1andAjFTL-2could only respond to higher concentration of PGN and LPS, respectively. Moreover, we found that the activity ofAjFTL-1was significantly increased by 1.72-fold (P＜ 0.05) and 1.67-fold (P＜ 0.05) with 0.1 and 1 μg mL?1MAN treatments for 24 h, respectively. The activity ofAjFTL-2was induced by2.44-fold (P＜ 0.05)with 1 μg mL?1MAN treatment, indicatingAjFTL-1was susceptible to MAN treatment. In all, we speculated that theAjFTL-1promoter activity was significantly induced by PGN and MAN treatments, and theAjFTL-2promoter was susceptible to LPS and MAN challenges, suggesting the activities of the two Fucolectins promoters were regulated with different methods. Similar results were also reported in the four interleukin 17 promoters ofCynoglossus semilaevis, which were regulated differentially by LPS, PolyI:C, and PMA (Chiet al., 2015).

Fig.4 The promoter activities of AjFTL-1 and AjFTL-2. EPC cells are transfected with the promoter constructs F1 (?792/+23) and F2 (?653/+41). The cells are then treated with different concentrations of LPS (A), PGN (B), and MAN (C) for 24 h, respectively. The control group was only transfected with promoter constructs F1 (?792/+23) and F2 (?653/+41),respectively. Values are given as mean ± SD (n = 3). Asterisks indicate significant differences: *P ＜ 0.05, ** P ＜ 0.01.

3.4 Analysis of Potential Transcription Factor Binding Sites with Expression Vector Co-Transfection

NF-κB acts as transcription factor and plays an important role in the regulation of innate immunity. Usually, the signals from microbial infection through PRRs recruit an adequate NF-κB family transcription factor which binds to NF-κB motif sites in the promoter of the respective defense genes, such as antibacterial genes, antifungal genes,and lectins (Engstr?m, 1999; Tanjiet al., 2002). Liet al.(2015) showed that bothLvDorsalandLvRelishcould upregulate the promoter activity of C-type lectin (LvCTL4)inLitopenaeus vanname, indicatingLvCTL4is a downstream molecule of the NF-κB signaling pathway. When we analyzed the functional promoter regions of these two genes, we found thatAjFTL-1contained two potential NFκB binding sites (?769 to ?761 bp, ?185 to ?172 bp), andAjFTL-2included one binding site (?530 to ?517 bp) in the limited sequence. In order to study the role of NF-κB binding site in regulating these two genes’ expressions, the promoter plasmid and expression plasmid of AjRel were co-transfected into EPC cells (Fig.5). Our results showed that when the fragment of F2 (?653/+41) was co-transfected with pCMV-Flag 2C-Rel, the luciferase activity was markedly increased by 1.55-fold (P＜ 0.05) compared with empty expression vector of pCMV-Flag 2C. After deleting the NF-κB binding site, the luciferase activity was decreased to control level, indicating the NF-κB binding site (?530 to ?517 bp) was necessary forAjFTL-2transcription. However, there were no significant changes ofAjFTL-1expression with different truncated promoters transfecting with expression vector,indicating theNF-κB transcription factor might not necessary for its transcription in the studied region. In vertebrates, lectins can directly activate diverse signaling pathways including NF-κB signaling pathway (Geijtenbeeket al., 2009). WhetherAjFTL-1orAjFTL-2can regulate the NF-κB pathway will be studied in our further work.

Fig.5 Activation of AjFTL-1 and AjFTL-2 by transcription factor NF-κB. EPC cells are co-transfected with different truncated promoter vectors and vectors expressing the transcription factor NF-κB/Rel, respectively. Controls are co-transfected with empty pCMV-Flag 2C vector and different truncated promoter vectors, respectively. The data are expressed as fold increase relative to reporter constructs co-transfected with empty pCMV-Flag 2C vector, respectively. Values are given as mean ± SD(n = 3). Asterisks indicate significant differences: *P ＜0.05, ** P ＜ 0.01.

4 Conclusions

In this study, the structure and promoter activities of two F-type lectin family genesAjFTL-1andAjFTL-2in sea cucumber were compared. The promoters of these two genes both possess numerous potential transcription factors binding sites and are regulated differentially by LPS,PGN, and MAN. Moreover, the transcription factor of NF-κB/Rel can activate theAjFTL-2transcription, but notAjFTL-1transcription in a finite promoter sequence. Our results suggest that different members of F-type lectins might play distinct immunological roles and are regulated in different methods during pathogen infection.

Acknowledgements

This work was financially supported by the National Natural Science Foundation of China (No. 31802331), the Natural Science Foundation of Zhejiang Province (Nos.LZ19C190001, LY20C190002), the Natural Science Foundation of Ningbo (No. 2018A610340), and the K.C. Wong Magna Fund in Ningbo University.