, , , QI ,

1. Suzhou Chien-shiung Institute of Technology, Suzhou 215411, China; 2. Agricultural College, Yangzhou University, Yangzhou 225009, China; 3. Suzhou Academy of Agricultural Sciences, Suzhou 215000, China

1 Introduction

The genetic basis of China’s rice breeding varieties is weak and narrow, the genetic diversity of the bred varieties decreases gradually, and the genetic differences between the bred parents are very close[1-5]. With increasing levels of breeding, the simplification trend of crop variety extension is increasingly evident, resulting in loss of considerable genes and reduction of genetic diversity[6-8]. Jin Weidongetal.[9]use 60 pairs of SSR markers to study the genetic differences between the varieties currently promoted in the Taihu Lake area, and find that the average similarity coefficient between varieties reaches 0.902. Taihu Lake Basin began rice production as early as 8000 years ago[10], and japonica rice was mainly cultivated. Long-term natural evolution and artificial selection have brought rich rice genetic resources in the region[11-12], but so far, the breeding has been only limited to a few landraces such as Huangke Zaonianri, Aininghuang and Laohudao, and the utilization potential of the vast majority of resources has not been tapped. With the development of molecular biology, some genes are found to be related with starch formation or rice quality formation, including granular starch synthase gene (Wx), branching enzyme gene (Sbe1,Sbe3), soluble starch synthase gene (Sss1), iso-amylase gene (Isa) and limit dextrinase or R enzyme gene (Pull). Wu Hongkaietal.[13]useWxgene to study the RVA profile, and find that all eight eigenvalues of RVA play a major role, and have significant epistasis effect on amylopectin biosynthesis-related genesSbe1,Sss1. With 53 indica and japonica varieties and the high-yielding rice varieties bred in recent years as materials, Yan Changjieetal.[14]design molecular marker ofWx,Sbe1 andSbe3 genes and analyze the genetic effect of three gene loci. Chen Fengetal.[15]useWx,Sbe1,Sbe3 markers to analyze the effect of three genes on rice physicochemical quality and RVA profile characteristics, and find that there are significant differences in starch physicochemical properties among different genotype varieties (AC, GC, RVA), and there are also significant differences in the combined effects of three genes between different genotype combinations. Jin Weidongetal.[9]use SSR (Simple Sequence Repeat) to conduct the polymorphic DNA analysis on the core germplasm of 129 japonica landraces resources in Taihu Lake Basin, and the results show that there are not only rich genetic variations, but also a lot of rare allelic variations for the germplasm of the japonica landraces in Taihu Lake Basin. Yu Pingetal.[16]use 45 pairs of SSR primers to analyze the genetic diversity of 224 japonica landraces in Taihu Lake Basin, and find that the SSR diversity of japonica landraces is low and there are many rare allelic genes. Luo Bing[17]uses SSR primer to analyze the genetic diversity of 42 japonica rice varieties in the Taihu Lake area, and the results show that the average genetic similarity coefficient between the varieties is 0.6100, the test materials are highly similar, and the average PIC of each polymorphic locus is 0.4966. Debjanietal.[18]use 36 pairs of SNP to mark 12 rice chromosomes and analyze the genetic diversity of 6984 rice varieties in Northeast India, and find that PIC is 0.004-0.375, and genetic diversity is 0.006-0.500. Mehrzadetal.[19]use 52 primers distributed on 12 pairs of chromosomes to detect the genetic diversity of 94 genotypes of rice, and find that the highest and lowest PIC content is 0.892 and 0.423, respectively. In this study, we use the internal marker of starch synthesis gene closely related to rice quality to detect the marker genotypes of rice landraces in Taihu Lake Basin, and carry out the genetic diversity analysis and evaluation. According to UPGMA method, clustering is performed on 511 rice materials and 86 bred rice varieties, to reveal the genetic differences in quality gene between rice landraces resources in Taihu Lake Basin.

Table1Starchsynthesis-relatedintragenicmolecularmarker

TargetgeneMolecularmarkersPrimersequenceMarkertypeDistinguishablealleleWxNDND-F:CACAGCAACAGCTAGACAACCACND-R:CACGACGACGGAGGGGAACSTSWx/wxPCR-AccIpAg:ACCATTCCTTCAGTTCTTTTGpBg:ATGATTTAACGAGAGTTGAACAPSWxa/Wxb(CT)nF:CTTTGTCTATCTCAAGACACR:TTGCAGATGTTCTTCCTGATGSSR(CT)8/(CT)11/(CT)16/(CT)17/(CT)18/(CT)19/(CT)20(AATT)nF:TGCATCTTTCATTGCTCGTTR:ACCCCTGGATGTGTTTCTCTSSR(AATT)5/(AATT)6GBSSIIS004S004-F:TTGCTGCGAATTATCTGCGS004-R:ACCTCCTCCCACTTCTTTGCSTSGBSSIIaorhybrid/GBSSIIbSBE1S005S005-F:GAGTTGAGTTGCGTCAGATCS005-R:AATGAGGTTGCTTGCTGCTGSTSSbe1j/Sbe1iSBE3S006S006-F:TCGGTCCTAATATTTTGCGCTGS006-R:CCTTAACTTGACACCGAATCCSTSSbe3j/Sbe3iSSSI488/489488:GATCCGTTTTTGCTGTGCCC489:CCTCCTCTCCGCCGATCCTGSTSSssIj/SssIi/SssIa/SssIbS001S001-F:GTAGGCAAGCTGCTACTTGTS001-R:CTTGAGGCGCTAATCAGGTTSTSHavingband/havingnobandPCR-HaeIISSSⅠ-22:CCAAAGCCTGTAATAATAAGSSSⅠ-23:CACGCTAAACGAAGAAATCAPSSssIj/SssIiSSSII-1S008S008-F:CACCCCACCGTTCTACTATGCS008-R:TCCATAGTTTCATTGAGATT-GCTCSTSSSSII-1a/SSSII-1b/SSSII-1cSSSII-2S009S009-F:AGATTTGAACTCAGGACTTG-GTGS009-R:TCTATGGGCTCTATCCTTAC-TAGGSTSSssII-2j/SssII-2iSSSII-3PCR-TaqⅠS003-F:GCACTCCTGCCTGTTTATCT-GAAGS003-R:GTCGTACAGCTTGAAGTGATC-CAGCAPSSSSII-3aorSSSII-3b/SSSII-3cPCR-BanⅡS020-F:GGTTCTCGGTGAAGATGGCS020-R:GTGGTCCCAGCTGAGGTCCCAPSSSSII-3aorSSSII-3c/SSSII-3bSSSIII-1S010S010-F:AAGAAGGGAAGGGAGTCAGCS010-R:GCCATCTCCATTGCCAGCSTSSSSIII-1a/SSSIII-1b/SSSIII-1c/hybridSSSIII-2S011S011-F:GACCAACCGATTACCTTCTTS011-R:TTGCTCTTTTCTCAACCTGTSTSSSSIII-2aorSSSIII-2c/SSSIII-2bPCR-XbaⅠS012-F:AAGTCCTTCGGCTTACTATTCCS012-R:GGAGAAGGAACATAACAGGGACCAPSSSSIII-2a/SSSIII-2borSSSIII-2cSSSIV-1AY2AY2-F:GCTTTCAGTTGTGTATGGATTCAY2-R:TGAGAGTTTTACCTTATGGGACSTSSSSIV-1a/SSSIV-1bSSSIV-2AY1AY1-F:TTCGTTCTCAGTAGTCTGCTCCTAY1-R:TTGCTAATGAATGTGCTGTGG-TASTSSSSIV-2a/SSSIV-2b/SSSIV-2cISA-1S015S015-F:ATAGATGCTAATGTGATGTGGCS015-R:TGGTATAGGCACAACCGTAGASTSISAa/ISAbPULLS016S016-F:CTGTATGGACTGAGTAGTCGAT-GGS016-R:TGAGCCTCATCTGCCAGAGTSTSPULa/PULbAGPlarS017S017-F:CGTTCAGGTTCAGGCAATCAS017-R:GGAAGGGTGGTGATGTGGAGSTSAGPlara/AGPlarb/AGPlarcAGPsmaS018S018-F:TCTATTCTCAGCCCTCCAACCS018-R:GTGTGTTTAGAGGTGCTTTTGGSTSAGPsmaa/AGPsmabAGPisoPCR-EcorⅠS019-F:TGGAATGGGAACTCTATTATT-GGS019-R:TCCCAACCTCTACCTTCAAATGCAPSAGPisoa/AGPisob/hybrid

2 Materials and methods

511 rice landraces in the Taihu Lake area are planted in Suzhou Academy of Agricultural Sciences, including 423 japonica landraces, 15 glutinous rice landraces, 39 japonica glutinous rice landraces, 29 indica landraces, 5 indica glutinous rice landraces, and 86 varieties bred from a wide range of sources. At the seedling stage, the sampling and DNA extraction are conducted, and intragenic marker detection is conducted in the laboratory (Table 1). These marker loci are related to 19 starch synthesis genes. In autumn, these materials are harvested in batches, and some quality traits are measured, such as apparent amylose content, gel consistency and gelatinization temperature[20-21].

2.1MarkergenotypedetectionSDS method is used to extract DNA, and the corresponding primers in each sample are used for PCR amplification, and if it is CAPS molecular marker, there is also a need to perform the corresponding enzyme digestion of PCR product. PCR product or enzyme digestion product separates DNA fragments of different sizes by 1% agarose or 6% polyacrylamide gel electrophoresis. Electrophoresis conditions are selected based on the size of the difference in polymorphic bands. If it is greater than 50 bp, the agarose gel is used, and it is stained with EB after electrophoresis; if it is smaller than 10 bp, the polyacrylamide gel is used. After electrophoresis, the silver staining method is used to display DNA bands, and the results are scanned by ScanMaker 3830 (Microtek, Shanghai, China).

2.2StatisticalanalysisOne locus is detected for one pair of primers, and each polymorphic band is one allele. The allele of all test materials is recorded. The software PowerMarker 3.25[22]is used for general statistical analysis, to obtain number of alleles, allelic variation frequency, genetic diversity, polymorphic information content (PIC)[23], and other parameters. The Nei’s genetic distance matrix between individuals and subgroups is further calculated, unweighted pair-group method with arithmetic means (UPGMA) is used for genetic clustering analysis, and MEGA4.0 is used for observing clustering map.

3 Results and analysis

3.1Analysisofstarchsynthesis-relatedgeneticdiversityThe japonica landraces and the bred japonica rice varieties are compared (Table 2), and the results show that the average genetic diversity of japonica landraces is 0.1988, ranging from 0.0094 to 0.6520, and the average PIC is 0.1726, ranging from 0.0094 to 0.5887. The polymorphism of (CT)ngenetic locus is highest, while the polymorphism of Pull genetic locus is lowest. The average diversity of the bred japonica rice gene is 0.1282, ranging from 0.0000 to 0.5116, and the average PIC is 0.1101, ranging from 0.0000 to 0.3929. The polymorphism of SSSIII-2 genetic locus is highest, while the polymorphism ofWx,AATT,SSSVI-2 genetic loci is lowest. By comparison, it is found that the japonica landraces have higher genetic diversity and PIC than the bred japonica rice varieties.

Table2Geneticdiversityofthejaponicalandracesandthebredjaponicaricevarieties

GeneJaponicalandracesNumberofallelesGeneticdiversityPICThebredjaponicariceNumberofallelesGeneticdiversityPICWx3.00000.51070.39181.00000.00000.0000(CT)n8.00000.65200.58872.00000.33470.2787AATT2.00000.08580.08211.00000.00000.0000GBSSⅡ2.00000.10280.09752.00000.02470.0244Sbe12.00000.49220.37102.00000.34880.2879Sbe32.00000.05510.05362.00000.04880.0476SSSⅠ4.00000.11350.11152.00000.02470.0244SSSⅡ-13.00000.49820.38323.00000.11840.1138SSSⅡ-22.00000.11540.10872.00000.02470.0244SSSⅡ-33.00000.11720.11373.00000.39340.3253SSSⅢ-14.00000.24390.22673.00000.14130.1359SSSⅢ-23.00000.13730.13063.00000.51160.3929SSSⅥ-12.00000.11540.10872.00000.02470.0244SSSⅥ-22.00000.03710.03641.00000.00000.0000Isa-12.00000.12360.11602.00000.07220.0696Pull2.00000.00940.00942.00000.02470.0244AGPlar3.00000.11270.10922.00000.07220.0696AGPsma3.00000.10790.10382.00000.07220.0696AGPiso2.00000.14780.13692.00000.19970.1797Mean2.84210.19880.17262.05260.12820.1101

3.2ClusteringanalysisbasedongeneticdistanceBased on the Nei’s genetic distance between materials, the UPGMA method is used for cluster analysis of 511 rice materials and 86 bred rice varieties. The entire group can be divided into six categories, as shown in Fig. 1. From the cluster diagram, it is found that the bred japonica rice varieties are mainly in the right upper half of Group II and Group III, and japonica landraces are mainly concentrated in the second half of Group III, Group Ⅳ, Ⅴ, Ⅵ. Both of them are in different areas, and there have been significant genetic differentiation. Group I mainly includes indica landraces. It is also found that a small number of cultivars are still mixed in the landraces, and show consistent performance in terms of allele combination. In the tree diagram, the bred varieties Yangdao 6 and Shuijing 3 are genetically close to landraces Shuijingbaidao and Xishihuang. By contrast, a few landraces are also included in the bred varieties. In the tree diagram, the landraces Lujingqing and Sujing 5 are genetically close to the bred varieties Huaidao 11 and Nanjing 44. The results show that for the rice germplasm resources in the Taihu Lake area, there is great similarity and small genetic difference between a few landraces and a few bred varieties, while there is a small similarity between most landraces and the bred varieties, and they are in different groups, with great genetic difference.

Fig.1Clusteringof511landracesand86bredvarieties

3.3ClassificationofqualitytraitsBased on national standards of quality rice[24], the landraces are classified (Tables 3, 4 and 5). In terms of gel consistency trait, when indica rice≥70mm, japonica rice≥80mm, indica glutinous rice≥100mm, japonica glutinous rice≥100mm, it is at the first level. It can be seen from Table 4 that the indica rice has 5 landraces with first level gel consistency, accounting for 0.978% of total landraces in the Taihu Lake area; the japonica rice has 109 landraces with first level gel consistency, accounting for 21.33% of total landraces; the japonica glutinous rice has 21 landraces with first level gel consistency, accounting for 4.11% of total landraces; the indica glutinous rice has only one landrace (Majinnuo) with first level gel consistency. Based on national standards of amylose content, when indica rice dry basis content is 17%-22%, japonica rice dry basis content is 15%-18%, indica glutinous rice dry basis content is ≤2.0%, japonica glutinous rice dry basis content is ≤2.0%, it is at the first level. Table 4 shows that the indica rice has 18 landraces with first level of amylose, accounting for 3.52% of total landraces in the Taihu Lake area; the japonica rice has 156 landraces with first level of amylose, accounting for 30.53% of total landraces; the japonica glutinous rice has 10 landraces with first level of amylose, accounting for 1.96% of total landraces. Based on national standards of gelatinization temperature[25], when indica rice>4, japonica rice>6, glutinous rice>6, it is at the first level. Table 3 shows that the indica rice has 6 landraces with first level gelatinization temperature, accounting for 1.17% of total landraces in the Taihu Lake area; the japonica rice has 137 landraces with first level gelatinization temperature, accounting for 26.81% of total landraces; the glutinous rice has 3 landraces with first level gelatinization temperature, accounting for 0.59% of total landraces. In summary, the gel consistency, gelatinization temperature or amylose content can reach first level for most of japonica landraces in the Taihu Lake area.

Table3ThejaponicalandracesreachingthefirstlevelstandardintheTaihuLakearea

VarietiesTypeAC15%-18%GT>6GC≥80VarietiesTypeAC15-18%GT>6GC≥80345Japonicarice11LidongdaoJaponicarice11AibaidaoJaponicarice11LidongqingJaponicarice11AidatouJaponicarice11LigengqingJaponicarice11AijidaluzhongJaponicarice11LonggouzhongJaponicarice11AijidaluzhongJaponicarice11LuhuangzhongJaponicarice1AijiguangJaponicarice11LuhuangzhongJaponicarice11AijihuangJaponicarice11LujingqingJaponicarice11AijiaotaihuqingJaponicarice11LujingqingJaponicarice11AizibaigetouJaponicarice11LuoshuangqingJaponicariceBaidieguJaponicarice11LuoshuangqingJaponicarice1BaikelaolaiqingJaponicarice11LuoshuangqingJaponicarice1BaikelaolaiqingJaponicarice11LuoshuangqingJaponicarice1BaimangduanzhongJaponicarice11ManluzhongJaponicarice11BaimangduanzhongJaponicarice1MuduzhongJaponicarice11BaishidaoJaponicarice11PutaoluzhongJaponicarice11BaijidaoJaponicarice1SanzhaoqiJaponicarice11BaoxintaihuqingJaponicarice111SanguangdaoJaponicarice11BuxiguiJaponicarice11SanpingtouJaponicarice11ChangshuhuangJaponicarice11ShanghaiqingJaponicarice1chiguwandaoJaponicarice11ShanghaiqingJaponicarice1DadaosuitouJaponicarice11ShiluzhongJaponicarice11DaheitouhongJaponicarice11ShuangjiangqingnuodaoJaponicarice1DaliangdaoJaponicarice11SuzhouqingJaponicarice1DaluzhongJaponicarice11TieganyishixingJaponicarice11DamandaoJaponicarice11TiegandaoJaponicarice11DaqingzhongJaponicarice11TuoguoshanJaponicarice1DasuitoujingdaoJaponicarice11WanbaguoJaponicarice11DaichangqingJaponicarice111WanluohandaoJaponicarice11DiezhongJaponicarice11WannuodaoJaponicarice1DingzhuangdaoJaponicarice11WangjiadaoJaponicarice11Dongting2Japonicarice11WumangwanbagetouJaponicarice11DuanmangmengzijingdaoJaponicarice1WumangyedaoJaponicarice11DuiguzhongJaponicarice11WumangzaodaoJaponicarice1FenghuangdaoJaponicarice11WuxiyedaoJaponicarice11GaidaoqingJaponicarice11WuqitouJaponicarice111Guangtou853Japonicarice1Xidao16Japonicarice11GuangtoudadaoJaponicarice11XihongkeJaponicarice11HeidaoJaponicarice1XiangjingdaonuoJaponicarice1HeikeluhuabaiJaponicarice11XiangjingdaonuoJaponicariceHongkenuoJaponicarice1XiangjingdaonuodaoJaponicarice1HongkenuoJaponicarice1XiangzhunuoJaponicarice1HongkenuoJaponicarice1XiangzhunuoxuanJaponicarice1HongmangnuoJaponicarice11XiaohongzaoJaponicarice1HongmangxiangjingdaonuoJaponicarice1XiaoluohanJaponicarice11HongmuxiqiuJaponicarice1XiaoluohanhuangJaponicarice1HuangjingdaoJaponicarice11Xiaomai2Japonicarice11JijiaohongJaponicarice1XiaoqingzhongJaponicarice11JijingdaoJaponicarice11XiekehuangJaponicarice11JiangbeinuoJaponicarice1YanhongdaoJaponicarice11JiangxinuoJaponicarice1YangfeilaifengJaponicarice1JiangyinzaoJaponicarice1YangzaonianriJaponicarice11JinguhuangJaponicarice11YeliXJaponicarice11

Table4TheglutinousriceandjaponicaglutinousricelandracesreachingthefirstlevelstandardintheTaihuLakearea

VarietiesTypeAC≤2.0%GT>6GC≥100VarietiesTypeAC≤2.0%GT>6GC≥100AizinuoGlutinousrice1HuangnuoJaponicaglutinousrice11EbusinuodaoGlutinousrice11JiangyinnuoJaponicaglutinousrice1HuangjinnuoGlutinousrice1JinhuanuoJaponicaglutinousrice11HuangjingnuodaoGlutinousrice11JintainuoJaponicaglutinousrice1HuangnuoGlutinousrice11JingdaogunuoJaponicaglutinousrice1HuangnuoGlutinousrice11MaonuoJaponicaglutinousrice11QiangdaonuoGlutinousrice11NiaoxiunuoJaponicaglutinousrice1ShuijingnuoGlutinousrice1PutaonuoJaponicaglutinousrice1XichainuoGlutinousrice11WushinuoJaponicaglutinousriceXueliqingnuodaoGlutinousrice111YangnuodaoJaponicaglutinousrice1GuozinuoJaponicaglutinousrice1Yangxiandaon-uoJaponicaglutinousrice11HongkenuoJaponicaglutinousriceYishixingJaponicaglutinousrice11HongmangnuoJaponicaglutinousrice1ZaonuodaoJaponicaglutinousrice1HuajiaonuoJaponicaglutinousrice11ZhimanuoJaponicaglutinousrice11HuangsanshinuodaoJaponicaglutinousrice11

Table5TheindicalandracesreachingthefirstlevelstandardintheTaihuLakearea

VarietiesTypeAC17%-22%GT>4GC≥70VarietiesTypeAC17%-22%GT>4GC≥70GuiyuanhuangIndicarice1XiandaoIndicarice1DadaotouIndicarice1YangxiandaoIndicarice1HongmangyishixingIndicarice1WanduzixiandaoIndicarice11JiaobaixiandaoIndicarice1DatouguiIndicarice11WanxiandaoIndicarice1LiushiriIndicarice1WuxidaoIndicarice1XiandaoIndicarice1JiangyinzaoIndicarice1DuzixiandaoIndicarice1ZaohonglianIndicarice11WujiangguangzaoIndicarice1JianliziIndicarice1BashirizaoIndicarice11TaihuliushiziIndicarice1WanjinxiandaoIndicarice1BashiziIndicarice1TaihuxiandaoIndicarice1WujiangxiandaoIndicarice11

4 Conclusions and discussions

In this study, with 511 rice landraces in the Taihu Lake area as test materials, we choose 19 starch synthesis-related intragenic molecular markers to detect the genetic quality of starch, and compare them with 86 bred varieties. The genetic diversity of rice landraces in Taihu Lake Basin is slightly lower than that of the bred rice varieties in 6 genetic loci (AGPsma,AGPiso,Pull,SSSⅢ-2,SSSⅡ-3,Sbe3), but the average genetic diversity or PIC value of landraces is slightly higher than that of the bred rice varieties. The bred varieties are selected from a wide range of sources, such as American rice, Japanese rice and some domestic varieties from the south to the north, while the landraces are all local varieties in Taihu Lake Basin. From the results of cluster analysis, all study materials are divided into 6 groups, and Group I mainly includes the commonly used indica rice; the bred japonica varieties and the japonica landraces are concentrated in different regions, and there has been genetic differentiation. Therefore, it is necessary to study and utilize the quality genetic diversity of landraces so as to broaden the genetic basis of future breeding of high-quality new rice varieties. The materials selected in this study are selected from nearly 1000 landraces in the Taihu Lake area according to the differences in quality traits. According to the national standards of high quality rice, in terms of amylose content, gelatinization temperature and gel consistency, 67 landraces reach the first level standard in one trait; 95 landraces reach the first level standard in two traits; 4 landraces reach the first level standard in three traits.Although these old landrace resources have high plant and low resistance to lodging, they still make good performance in starch quality traits, and these varieties can be used to broaden the genetic basis of starch synthesis gene and quality breeding in the future.

[1] QI YW, ZHANG DL, ZHANG HL,etal. On the genetic diversity of the slection of Chinese rice variaties and its variation trend in recent 50 years[J]. Chinese Science Bulletin, 2006, 51(6): 693-699. (in Chinese).

[2] JIANG SK, WANG ZH, ZHONG M,etal. Simple sequence repeat (SSR) analysis of main rice (Oryza sativa L.) cultivars in Liaoning Province in the last 15 years[J]. Plant Physiology Communications, 2007, 43(1): 69-72. (in Chinese).

[3] HAO W, ZHANG X, XU ZJ,etal. The three northeast provinces of rice genetic diversity and genetic relationship of the SSR[J]. Journal of Henan Agricultural Sciences, 2008(4): 18-24. (in Chinese).

[4] WEI XH, YUAN XP, YU HY,etal. SSR analysis of genetic variation in Chinese major inbred rice varieties[J]. Chinese Journal of Rice Science, 2009, 23(3): 237-244. (in Chinese).

[5] LI HY, HOU YM, CHEN YH,etal. Evaluation on genetic diversity of the commercial rice varieties in northeast China by mierosatellite markers[J]. Chinese Journal of Rice Science, 2009, 23(4): 383-390. (in Chinese).

[6] TILMAN D. The greening of the green revolution[J]. Nature, 1998, 396: 211-212.

[7] DONINI P, LAW JR, KOEBNER RMD,etal. Temporal trends in the diversity of UK wheat[J]. Theoretical and Applied Genetics, 2000, 100(6): 912-917.

[8] TIAN QZ, ZHOU RH, JIA JZ. Genetic diversity trend of common wheat (Triticum aestivum L) in China revealed with AFLP markers[J]. Genetic Resources and Crop Evolution, 2005, 52(3): 325-331.

[9] JIN WD. Heterosis and genetic diversity of Japonica rice (Oryza Sativa L.) in Taihu Lake Valley[D]. Nanjing: Nanjing Agricultural University，2006. (in Chinese).

[10] WANG CL, ZOU JS, TANG LH,etal. Rice cultivation at the Neolithic age in Taihu region[J]. Jiangsu Journal of Agricultural Sciences, 2000, 16(3): 129-138.

[11] JIANG H, WANG G L, WU JL,etal. Japonica rice germplasm in Taihu Lake region[J]. Crop Germplasm, 1986, 2(4): 5-8.

[12] GUO EN, HUA GH, GAO JC,etal. Evolution and utilization of rice cul-tivars in Taihu region[J]. Jiangsu Journal of Agricultural Sciences, 1986, 2(4): 42-44.

[13] WU HK, LIANG GH, GU YJ,etal. The effect of the starch-synthesizing genes on RVA profile characteristics in rice (Oryza sativa L.)[J].

Acta Agronomica Sinica, 2006, 32(11): 1597-1603. (in Chinese).

[14] YAN CJ, TIAN S, ZHANG ZQ,etal. The source of genes related to rice grain starch synthesis among cultivated varieties and its contribution to quality[J]. Scientia Agricultura Sinica, 2005, 39(5): 865-871. (in Chinese).

[15] CHEN F, SUN GC, YANG ZF,etal. The effects of starch-synthesizing genes on rice quality[J]. Acta Agriculturae Boreali-Sinica, 2009, 24(2): 55-59. (in Chinese).

[16] YU P, LI L, LV JZ,etal. SSR Analysis on japonica rice landraces from the Taihu Lake Region, China[J]. Chinese Journal of Rice Science， 2009, 23(2): 148-152. (in Chinese).

[17] LUO B, XU GM, SUN HY,etal. Genetic diversity analysis of modern japonica rice (Oryza satiua L.) from Taihu area based on simple sequence repeat (SSR) markers[J]. Journal of Agricultural Biotechnology, 2014, 22(12): 1502-1513. (in Chinese).

[18] ROY-CHOUDHURY D, SINGH N, SINGH AK,etal. Analysis of genetic diversity and population structure of rice germplasm from north-eastern region of India and development of a core germplasm se t[J]. Plos One, 2014, 9(11) : e113094.

[19] ALLHGHOLIPOUR M, FARSHDFAR E, RABIEI B,etal. Molecular characterization and genetic diversity analysis of different rice cultivars by microsatellite markers[J]. Genetika, 2014, 46(1): 187-192.

[20] HU PS, ZHAI HQ, TANG SQ,etal. A simplified method for evaluating gelatinization temperature and amylose content of rice[J]. Chinese Journal of Rice Science, 2003, 17(3): 284-286. (in Chinese).

[21] ZHANG YK, MIN J, WU XJ. Determination of gel consistency of rice[J]. Crops, 1985, 04(23):34. (in Chinese).

[22] LIU K, MUSE SV. Powermarker: An integrated analysis environment for genetic marker analysis[J]. Bioinformatics, 2005, 21(9): 2128-2129.

[23] BOTSTEIN D, WHITE RL, SKOLNICK M,etal. Construction of a genetic linkage map in man using restriction fragment length Polymorphisms[J]. American Journal of Human Genetics,1980, 32(3): 314-331.

[24] LI SQ, LIANG GS, LI WH. The breeding of new standard of national high-quality rice and high-quality japonica rice[J]. Reclaiming and Rice Cultivation, 2001, 3(1): 6-7. (in Chinese).

[25] ZENG YC. Introduction of the standard of national high-quality edible rice and high-quality rice[J]. Bulletin of Agricultural Science and Technology, 1987(3): 7-8. (in Chinese).